After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse CLEC10A natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CLEC10A cDNA Clone Product Information
NCBI RefSeq:NM_010796.2
RefSeq ORF Size:915bp
cDNA Description:Full length Clone DNA of Mus musculus C-type lectin domain family 10, member A.
Gene Synonym:Mgl, Mgl1, CD301a, Clec10a
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

CLEC10A, also known as the macrophage galactose-type calcium-type lectins (MGLs; CD301) constitute a unique class of C-type lectins because of their specificity for galactose and its structural homologues. MGLs/CD301 is a type II transmembrane glycoproteins and is expressed on macrophages and related cells of myeloid origins, particularly immature dendritic cells (DCs). There are 2 homologues: MGL1 and MGL2 (CD301a and CD301b) in mice. MGL1/CD301a induces both the production and secretion of interleukin (IL)-10. MGL1/CD301a plays a protective role against colitis by effectively inducing IL-10 production by colonic lamina propria macrophages in response to invading commensal bacteria.

References
  • Saba K, et al. (2009) A C-type lectin MGL1/CD301a plays an anti-inflammatory role in murine experimental colitis. Am J Pathol. 174(1): 144-52.
  • Suzuki N, et al. (2002) Molecular cloning and expression of cDNA encoding human macrophage C-type lectin: its unique carbohydrate binding specificity for Tn antigen. J Immunol. 1996 ;156: 128-135.
  • Tsuiji M, et al. (2002) Molecular cloning and characterization of a novel mouse macrophage C-type lectin, mMGL2, which has a distinct carbohydrate specificity from mMGL1. J Biol Chem. 277: 28892-28901.
  • Denda-Nagai K, et al. (2002) Macrophage C-type lectin on bone marrow-derived immature dendritic cells is involved in the internalization of glycosylated antigens. Glycobiology. 12: 443-450.
  • Size / Price
    Catalog: MG50707-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"