After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human PLK1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PLK1cDNA Clone Product Information
cDNA Size:1812
cDNA Description:ORF Clone of Homo sapiens polo-like kinase 1 (Drosophila) DNA.
Gene Synonym:PLK, STPK13, PLK1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human PLK1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged on other vectors
Related Products
Product nameProduct name

Serine / threonine-protein kinase PLK1 / PLK-1, also known as polo-like kinase 1 (PLK-1) or serine / threonine-protein kinase 13 (STPK13), Polo-like kinases (PLKs), is a family of four serine / threonine protein kinases that are critical regulators of cell cycle progression, mitosis, cytokinesis, and the DNA damage response. PLK1 / PLK-1 is ubiquitously expressed. The mRNA and protein expression of PLK1 / PLK-1, -2 and -4 are coordinately regulated during cell cycle progression, but PLK3 levels are independent of the other three family members. PLK1 / PLK-1 is the most well characterized member of this family and strongly promotes the progression of cells through mitosis. During the various stages of mitosis PLK1 / PLK-1 localizes to the centrosomes, kinetochores and central spindle. PLKs are dysregulated in a variety of human cancers. PLK1 / PLK-1 overexpression correlates with cellular proliferation and poor prognosis. Serine / threonine-protein kinase that performs several important functions throughout M phase of the cell cycle, including the regulation of centrosome maturation and spindle assembly, the removal of cohesins from chromosome arms, the inactivation of APC / C inhibitors, and the regulation of mitotic exit and cytokinesis. It is required for recovery after DNA damage checkpoint and entry into mitosis. PLK1 / PLK-1 is required for kinetochore localization of BUB1B, spindle pole localization of isoform 3 of SGOL1 and plays a role in regulating its centriole cohesion function. PLK1 / PLK-1 Phosphorylates BORA, and thereby promotes the degradation of BORA. PLK1 / PLK-1 also contributes to the regulation of AURKA function and phosphorylates SGOL1.

  • Lee KS, et al. (2008) Self-regulated mechanism of Plk1 localization to kinetochores: lessons from the Plk1-PBIP1 interaction. Cell Div. 3: 4.
  • Zhou T, et al. (2003) A role for Plk1 phosphorylation of NudC in cytokinesis. Dev Cell. 5 (1): 127-38.
  • Lee M, et al. (2004) Phosphorylation of BRCA2 by the Polo-like kinase Plk1 is regulated by DNA damage and mitotic progression. Oncogene. 23 (4): 865-72.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items