Quick Order

Mouse CHODL natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CHODL cDNA Clone Product Information
Gene_bank_ref_id:NM_139134.3
RefSeq ORF Size:822bp
cDNA Description:Full length Clone DNA of Mus musculus chondrolectin.
Gene Synonym:MT75, PRED12, 3110074E07Rik, Chodl
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
References
  • Weng L, et al. (2003) A novel alternative spliced chondrolectin isoform lacking the transmembrane domain is expressed during T cell maturation. J Biol Chem. 278(21): 19164-70.
  • Masuda K, et al. (2011) Chondrolectin is a novel diagnostic biomarker and a therapeutic target for lung cancer. Clin Cancer Res. 17(24): 7712-22.
  • Weng L, et al. (2002) Molecular cloning and characterization of human chondrolectin, a novel type I transmembrane protein homologous to C-type lectins. Genomics. 80(1): 62-70.
  • Size / Price
    Catalog: MG50699-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"