Quick Order

Mouse UCHL3 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse UCHL3 cDNA Clone Product Information
Gene_bank_ref_id:NM_016723.2
RefSeq ORF Size:693bp
cDNA Description:Full length Clone DNA of Mus musculus ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase).
Gene Synonym:Uchl3
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Ubiquitin carboxyl-terminal hydrolase isozyme L3, also known as UCH-L3, Ubiquitin thioesterase L3 and UCHL3, is a ubiquitin-protein hydrolase which belongs to the peptidase C12 family. It is involved both in the processing of ubiquitin precursors and of ubiquitinated proteins. This enzyme is a thiol protease that recognizes and hydrolyzes a peptide bond at the C-terminal glycine of either ubiquitin or NEDD8. UCHL3 is highly expressed in heart, skeletal muscle, and testis. UCHL1 and UCHL3 are two of the deubiquitinating enzymes expressed in the brain. These phenotypes indicate the importance of UCHL1 and UCHL3 in the regulation of the central nervous system. UCHL3 functions as a de-ubiquitinating enzyme where lack of its hydrolase activity may result in the prominent accumulation of ubiquitinated proteins and subsequent induction of stress responses in skeletal muscle. UCHL3 has also been identified as a tumor-specific antigen in colon cancer.

References
  • Wood,M.A. et al., 2005, Hippocampus  15 (5):610-21.
  • Kwon,J. et al., 2006, Exp Anim  55 (1):35-43.
  • Setsuie,R. et al., 2009, Neurochem Int  54 (5-6):314-21.
  • Setsuie,R. et al., 2010, Neurochem Int  56 (8):911-8.
  • Size / Price
    Catalog: MG50692-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"