Quick Order

Human CaM Kinase 2A Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CAMK2AcDNA Clone Product Information
Gene_bank_ref_id:NM_171825.1
cDNA Size:1437
cDNA Description:ORF Clone of Homo sapiens calcium/calmodulin-dependent protein kinase II alpha DNA.
Gene Synonym:CAMKA, KIAA0968
Species:Human
Vector:pCMV3-C-FLAG
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
 
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human CaM Kinase 2A Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged on other vectors
Human CaM Kinase 2A Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10648-ACG$325
Human CaM Kinase 2A Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10648-ACR$325
Human CaM Kinase 2A Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10648-ANG$325
Human CaM Kinase 2A Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10648-ANR$325
Human CaM Kinase 2A Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10648-CF$295
Human CaM Kinase 2A Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10648-CH$295
Human CaM Kinase 2A Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10648-CM$295
Human CaM Kinase 2A Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10648-CY$295
Human CaM Kinase 2A Gene cDNA Clone (full-length ORF Clone)HG10648-M$95
Human CaM Kinase 2A Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10648-M-F$295
Human CaM Kinase 2A Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10648-M-N$295
Human CaM Kinase 2A Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10648-NF$295
Human CaM Kinase 2A Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10648-NH$295
Human CaM Kinase 2A Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10648-NM$295
Human CaM Kinase 2A Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10648-NY$295
Human CaM Kinase 2A Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10648-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

Ca2+/calmodulin-dependent protein kinase2A (CAMK2A) belongs to the serine/threonine protein kinase family and, together with other 28 different isoforms, belongs to the Ca2+/ calmodulin-dependent protein kinase subfamily. CaM kinase Ⅱ is thought to be an important mediator of learning and memory and is also necessary for Ca2+ homeostasis and reuptake in cardiomyocytes chloride transport in epithelia, positive T-cell selection, and CD8 T-cell activation. CAMKIIA is one of the major forms of CAMKII. It has been found to play a critical role in sustaining activation of CAMKII at the postsynaptic density. Studies have found that knockout mice without CAMKIIA demonstrate a low frequency of LTP. Additionally, these mice do not form persistent, stable place cells in the hippocampus.

References
  • Lin CR, et al. (1987). Molecular cloning of a brain-specific calcium/calmodulin-dependent protein kinase. Proc Natl Acad Sci U S A. 84 (16): 5962-6.
  • Walikonis RS, et al. (2001) Densin-180 forms a ternary complex with the (alpha)-subunit of Ca2+/calmodulin-dependent protein kinase II and (alpha)-actinin. J Neurosci. 21 (2): 423-33.
  • Gardoni F, et al. (2003) CaMKII-dependent phosphorylation regulates SAP97/NR2A interaction. J Biol Chem. 278 (45): 44745-52.
  • Size / Price
    Catalog:HG10648-CF
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"