Quick Order

Text Size:AAA

Mouse PLK1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse PLK1 cDNA Clone Product Information
Gene_bank_ref_id:NM_011121.3
RefSeq ORF Size:1812bp
cDNA Description:Full length Clone DNA of Mus musculus polo-like kinase 1 (Drosophila).
Gene Synonym:Plk, STPK13, Plk1
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Serine / threonine-protein kinase PLK1 / PLK-1, also known as polo-like kinase 1 (PLK-1) or serine / threonine-protein kinase 13 (STPK13), Polo-like kinases (PLKs), is a family of four serine / threonine protein kinases that are critical regulators of cell cycle progression, mitosis, cytokinesis, and the DNA damage response. PLK1 / PLK-1 is ubiquitously expressed. The mRNA and protein expression of PLK1 / PLK-1, -2 and -4 are coordinately regulated during cell cycle progression, but PLK3 levels are independent of the other three family members. PLK1 / PLK-1 is the most well characterized member of this family and strongly promotes the progression of cells through mitosis. During the various stages of mitosis PLK1 / PLK-1 localizes to the centrosomes, kinetochores and central spindle. PLKs are dysregulated in a variety of human cancers. PLK1 / PLK-1 overexpression correlates with cellular proliferation and poor prognosis. Serine / threonine-protein kinase that performs several important functions throughout M phase of the cell cycle, including the regulation of centrosome maturation and spindle assembly, the removal of cohesins from chromosome arms, the inactivation of APC / C inhibitors, and the regulation of mitotic exit and cytokinesis. It is required for recovery after DNA damage checkpoint and entry into mitosis. PLK1 / PLK-1 is required for kinetochore localization of BUB1B, spindle pole localization of isoform 3 of SGOL1 and plays a role in regulating its centriole cohesion function. PLK1 / PLK-1 Phosphorylates BORA, and thereby promotes the degradation of BORA. PLK1 / PLK-1 also contributes to the regulation of AURKA function and phosphorylates SGOL1.

References
  • Lee KS, et al. (2008) Self-regulated mechanism of Plk1 localization to kinetochores: lessons from the Plk1-PBIP1 interaction. Cell Div. 3: 4.
  • Zhou T, et al. (2003) A role for Plk1 phosphorylation of NudC in cytokinesis. Dev Cell. 5 (1): 127-38.
  • Lee M, et al. (2004) Phosphorylation of BRCA2 by the Polo-like kinase Plk1 is regulated by DNA damage and mitotic progression. Oncogene. 23 (4): 865-72.
  • Size / Price
    Catalog: MG50624-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"