Quick Order

Human SerpinB2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SERPINB2cDNA Clone Product Information
Gene_bank_ref_id:NM_002575.1
cDNA Size:1248
cDNA Description:ORF Clone of Homo sapiens serpin peptidase inhibitor, clade B (ovalbumin), member 2 DNA.
Gene Synonym:PAI, PAI2, PAI-2, PLANH2, HsT1201
Species:Human
Vector:pCMV3-C-FLAG
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
 
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human SerpinB2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged on other vectors
Human SerpinB2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10641-ACG$325
Human SerpinB2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10641-ACR$325
Human SerpinB2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10641-ANG$325
Human SerpinB2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10641-ANR$325
Human SerpinB2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10641-CF$295
Human SerpinB2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10641-CH$295
Human SerpinB2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10641-CM$295
Human SerpinB2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10641-CY$295
Human SerpinB2 Gene cDNA Clone (full-length ORF Clone)HG10641-M$95
Human SerpinB2 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10641-M-F$295
Human SerpinB2 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10641-M-N$295
Human SerpinB2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10641-NF$295
Human SerpinB2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10641-NH$295
Human SerpinB2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10641-NM$295
Human SerpinB2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10641-NY$295
Human SerpinB2 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10641-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

Serpins are the largest and most diverse family of serine protease inhibitors which are involved in a number of fundamental biological processes such as blood coagulation, complement activation, fibrinolysis, angiogenesis, inflammation and tumor suppression and are expressed in a cell-specific manner.
SerpinB2, also known as Plasminogen activator inhibitor 2, Placental plasminogen activator inhibitor, Monocyte Arg-serpin, Urokinase inhibitor and PAI2, is a cytoplasm protein which belongs to the serpin family and Ov-serpin subfamily. SerpinB2 is a major product of activated monocytes and macrophages and is substantially induced during most inflammatory processes. Distinct from its widely described extracellular role as an inhibitor of urokinase plasminogen activator. SerpinB2 has been shown to have an intracellular role as a retinoblastoma protein (Rb)-binding protein that inhibits Rb degradation. SerpinB2 is widely described as an inhibitor of urokinase plasminogen activator. SerpinB2 inhibits urokinase-type plasminogen activator. The monocyte derived SerpinB2 is distinct from the endothelial cell-derived PAI-1. SerpinB2 is a potentially important inducible host factor that significantly promotes HIV-1 replication.

References
  • Sumi, Y. et al., 1989, J. Biochem. 106: 703-7.
  • Rawlings, N.D. et al., 2004, Biochem J. 378: 705-16.
  • Gillard, A. et al., 2006, Am J Nephrol. 26 (1): 34-42.
  • Schroder,WA. et al., 2010, J Immunol. 184 (5): 2663-70.
  • Size / Price
    Catalog:HG10641-CF
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"