After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse TPST1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse TPST1 cDNA Clone Product Information
Gene_bank_ref_id:NM_001130476.1
RefSeq ORF Size:1113bp
cDNA Description:Full length Clone DNA of Mus musculus protein-tyrosine sulfotransferase 1.
Gene Synonym:R75054, Tpst1
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Protein-tyrosine sulfotransferase 1, also known as Tyrosylprotein sulfotransferase 1 and TPST1, is a single-pass type I I membrane protein which belongs to the protein sulfotransferase family. Tyrosine O-sulfation is a common posttranslational modification of proteins in all multicellular organisms. This reaction is mediated by a Golgi enzyme activity called tyrosylprotein sulfotransferase (TPST) that catalyzes the transfer of sulfate from 3'-phosphoadenosine 5'-phosphosulfate to tyrosine residues within acidic motifs of polypeptides. Tyrosine O-sulfation has been shown to be important in protein-protein interactions in several systems. Tyrosine sulfation is mediated by one of two Golgi isoenzymes, called tyrosylprotein sulfotransferases (TPST-1 and TPST-2). A relatively small number of proteins are known to undergo tyrosine sulfation, including certain adhesion molecules, G-protein-coupled receptors, coagulation factors, serpins, extracellular matrix proteins, and hormones. TPST1 is a human tyrosylprotein sulfotransferase that uses 3'phosphoadenosine-5'phosphosulfate (PAPS) to transfer the sulfate moiety to proteins predominantly designated for secretion. TPST1 bears N-linked glycosyl residues exclusively at position Asn60 and Asn262. TPST1 and TPST2 have distinct biological roles that may reflect differences in their macromolecular substrate specificity.

References
  • Ouyang Y.-B.et al., 1998, Proc. Natl. Acad. Sci. USA. 95: 2896-901.
  • Ouyang,Y.B. et al., 2002,J Biol Chem. 277 (26):23781-7.
  • Hoffhines, A.J. et al., 2006, J Biol Chem. 281 (49):37877-87.
  • Goettsch,S. et al., 2006, J Mol Biol. 361 (3):436-49.
  • Westmuckett, A.D. et al., 2008, Gen Comp Endocrinol. 156 (1):145-53.
  • Size / Price
    Catalog: MG50617-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"