Quick Order

Human GREM1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GREM1cDNA Clone Product Information
Gene_bank_ref_id:NM_013372.5
cDNA Size:555
cDNA Description:ORF Clone of Homo sapiens gremlin 1, cysteine knot superfamily, homolog (Xenopus laevis) DNA.
Gene Synonym:DRM, PIG2, DAND2, IHG-2, GREMLIN, CKTSF1B1, MGC126660
Species:Human
Vector:pCMV3-C-FLAG
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
 
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name
Background

GREM1 belongs to the DAN family. It contains 1 CTCK (C-terminal cystine knot-like) domain. GREM1 is a cysteine knot-secreted protein and acts as an inhibitor in the TGF beta signaling pathway. It inhibits BMP-2, -4, and -7. Inhibition by grem 1 of BMPs in mice allow the expression of fibroblast growth factors (FGFs) 4 and 8 and Sonic hedgehog (SHH) which are necessary for proper limb development. It interacts with SLIT1 and SLIT2 in a glycosylation-dependent manner. As a cytokine, GREM1 may play an important role during carcinogenesis and metanephric kidney organogenesis, as a BMP antagonist required for early limb outgrowth and patterning in maintaining the FGF4-SHH feedback loop. It down-regulates the BMP4 signaling in a dose-dependent manner. It also acts as inhibitor of monocyte chemotaxis. GREM1 is highly expressed in small intestine, fetal brain and colon.

References
  • Dimitrov BI, et al. (2010) Genomic rearrangements of the GREM1-FMN1 locus cause oligosyndactyly, radio-ulnar synostosis, hearing loss, renal defects syndrome and Cenani--Lenz-like non-syndromic oligosyndactyly. J Med Genet. 47(8):569-74.
  • Heron M, et al. (2011) Genetic variation in GREM1 is a risk factor for fibrosis in pulmonary sarcoidosis. Tissue Antigens. 77(2):112-7.
  • van Vlodrop IJ, et al. (2010) Prognostic significance of Gremlin1 (GREM1) promoter CpG island hypermethylation in clear cell renal cell carcinoma. Am J Pathol. 176(2):575-84.
  • Size / Price
    Catalog:HG10632-CF
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"