After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse CHST3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CHST3cDNA Clone Product Information
cDNA Size:1419
cDNA Description:ORF Clone of Mus musculus carbohydrate (chondroitin 6/keratan) sulfotransferase 3 DNA.
Gene Synonym:C6ST, GST-0, C6ST-1, Chst3
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name

Mouse carbohydrate sulfotransferase 3, also known as Chondroitin 6-O-sulfotransferase 1, Chondroitin 6-sulfotransferase and CHST3, is a single-pass type I I membrane protein which belongs to the sulfotransferase 1 family and Gal / GlcNAc / GalNAc subfamily. CHST3 is widely expressed in adult tissues. It is expressed in heart, placenta, skeletal muscle and pancreas. CHST3 is also expressed in various immune tissues such as spleen, lymph node, thymus and appendix. CHST3 catalyzes the transfer of sulfate to position 6 of the N-acetylgalactosamine (GalNAc) residue of chondroitin. It is a chondroitin sulfate which constitutes the predominant proteoglycan present in cartilage and is distributed on the surfaces of many cells and extracellular matrices. It can also sulfate Gal residues of keratan sulfate, another glycosaminoglycan, and the Gal residues in sialyl N-acetyllactosamine (sialyl LacNAc) oligosaccharides. It may play a role in the maintenance of naive T-lymphocytes in the spleen. Defects in CHST3 are the cause of spondyloepiphyseal dysplasia Omani type (SED Omani type) which is an autosomal recessive disorder characterized by normal length at birth but severely reduced adult height (110-130 cm), severe progressive kyphoscoliosis, arthritic changes with joint dislocations, genu valgum, cubitus valgus, mild brachydactyly, camptodactyly, microdontia and normal intelligence. As a consequence of the arthropathy and the contractures, affected individuals develop restricted joint movement. Defects in CHST3 are also a cause of humerospinal dysostosis (HSD) which is characterized by bifurcation of the ends of the humerus, subluxation in the elbow joints, widened iliac bones, talipes equinovarus and coronal cleft vertebrae. Congenital, progressive heart disease, possibly with fatal outcome, is observed in some patients.

  • Fukuta M., et al., 1998, Biochim. Biophys. Acta 1399:57-61.
  • Tsutsumi K., et al., 1998, FEBS Lett. 441:235-241.
  • Thiele H., et al., 2004, Proc. Natl. Acad. Sci. USA. 101:10155-10160.
  • Hermanns P., et al., 2008, Am. J. Hum. Genet. 82:1368-1374.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items