Quick Order

Mouse SERPINB9 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse SERPINB9 cDNA Clone Product Information
Gene_bank_ref_id:NM_009256.3
RefSeq ORF Size:1125bp
cDNA Description:Full length Clone DNA of Mus musculus serine (or cysteine) peptidase inhibitor, clade B, member 9.
Gene Synonym:PI9, CAP3, PI-9, Spi6, CAP-3, BB283241, ovalbumin, Serpinb9
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

SerpinB9, also known as Cytoplasmic antiproteinase 3, CAP-3, Peptidase inhibitor 9, SERPINB9 and PI-9, is a cytoplasm protein which belongs to the serpin family and Ov-serpin subfamily. Serpin-B9 ( CAP-3 / PI-9 ) is the only known human intracellular inhibitor of granzyme B (GrB), the effector molecule in immunity against cytomegalovirus (CMV) and in renal allograft rejection. Serpin-B9 and SPI-6 expression in immune-privileged cells, APCs, and CTLs protects these cells against the actions of granzyme B, and when expressed in tumor cells or virally infected hepatocytes, confers resistance to killing by CTL and NK cells. Expression of increasing levels of Serpin-B9 ( CAP-3 / PI-9 ) in target cells may progressively inhibit immune surveillance by blocking NK and CTL-induced cytotoxicity through the perforin / granzyme pathway and then through the Fas / FasL pathway. Serpin-B9 ( CAP-3 / PI-9 ) is selectively up-regulated in hepatocytes in response to infiltration of the liver by NK cells that express perforin and enzymatically active granzyme B. Upregulated expression of Serpin-B9 ( CAP-3 / PI-9 ) in NSCLC cells may serve to protect them from apoptosis induced by GrB.

References
  • Rowshani,A.T. et al., 2005, J Infect Dis.192 (11): 1908-11.
  • Cunningham,T.D. et al., 2007, Cell Immunol 245 (1): 32-41.
  • Rousalova,I. et al., 2010, Int J Oncol  36 (1): 275-83.
  • Stout-Delgado,H.W. et al., 2007, J Immunol. 179 (10):6561-7.
  • Size / Price
    Catalog: MG50563-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"