Quick Order

Cynomolgus monkey CD3D Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CD3DcDNA Clone Product Information
cDNA Size:600
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) CD3d molecule, delta (CD3-TCR complex) DNA.
Gene Synonym:CD3D
Restriction Site:KpnI + XbaI
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-FLAG Vector Information
Vector Name pCMV3-N-FLAG
Vector Size 6098bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-FLAG Physical Map
Schematic of pCMV3-N-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

T-cell surface glycoprotein CD3 delta chain, also known as CD3D, is a single-pass type I membrane protein. CD3D, together with CD3-gamma, CD3-epsilon and CD3-zeta, and the T-cell receptor alpha/beta and gamma/delta heterodimers, forms the T cell receptor-CD3 complex. The majority of T cell receptor (TCR) complexes in mice and humans consist of a heterodimer of polymorphic TCRalpha and beta chains along with invariant CD3gamma, delta, epsilon, and zeta chains. CD3 chains are present as CD3gammaepsilon, deltaepsilon, and zetazeta dimers in the receptor complex and play critical roles in the antigen receptor assembly, transport to the cell surface, and the receptor-mediated signal transduction. T cell receptor-CD3 complex plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways. This complex is critical for T-cell development and function, and represents one of the most complex transmembrane receptors. The T cell receptor-CD3 complex is unique in having ten cytoplasmic immunoreceptor tyrosine-based activation motifs (ITAMs). CD3D contains 1 ITAM domain and has been shown to interact with CD8A. In the mouse, knockout of CD3delta allows some degree of T lymphocyte differentiation since mature CD4 and CD8 as well as TCRgammadelta T lymphocytes are observed in the periphery. In contrast, deleterious mutation of the CD3delta encoding gene in the human leads to a severe combined immunodeficiency characterised by the complete absence of mature T cell subpopulations including TCRalpha/beta and TCRgamma/delta. Defects in CD3D cause severe combined immunodeficiency autosomal recessive T-cell-negative/B-cell-positive/NK-cell-positive (T-/B+/NK+ SCID) which is a genetically and clinically heterogeneous group of rare congenital disorders characterized by impairment of both humoral and cell-mediated immunity, leukopenia, and low or absent antibody levels. In humans the absence of CD3 delta results in a complete arrest in thymocyte development at the stage of double negative to double positive transition and the development of gamma delta T-cell receptor-positive T cells is also impaired.

  • Roifman CM. (2004) CD3 delta immunodeficiency. Curr Opin Allergy Clin Immunol. 4(6): 479-84.
  • Pan Q, et al. (2006) Different role for mouse and human CD3delta/epsilon heterodimer in preT cell receptor (preTCR) function: human CD3delta/epsilon heterodimer restores the defective preTCR function in CD3gamma- and CD3gammadelta-deficient mice. Mol Immunol. 43(11): 1741-50.
  • Le Deist F, et al. (2007) Expression anomalies of the CD3-TCR complex expression and immunodeficiencies. Med Sci (Paris). 23(2): 161-6.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 Business days
    • Cynomolgus monkey CD3D Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged
    Recently Viewed Items