Quick Order

Text Size:AAA

Cynomolgus monkey ANGPT2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ANGPT2cDNA Clone Product Information
cDNA Size:1488
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) Angiopoietin-2 DNA.
Gene Synonym:ANGPT2
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Angiopoietin/Tie Related Products

Angiopoietin-2 (ANG 2, or ANGPT2), is a member of the ANG family, which plays an important role in angiogenesis during the development and growth of human cancers. Both ANGPT-1 and ANGPT-2 appear to bind to the tyrosine kinase receptor, Tie-2, found primarily on the luminal surface of endothelial cells. ANG-2's role in angiogenesis generally is considered as an antagonist for ANG1, inhibiting ANG1-promoted Tie2 signaling, which is critical for blood vessel maturation and stabilization. ANG-2 modulates angiogenesis in a cooperative manner with another important angiogenic factor, vascular endothelial growth factor A. Genetic studies have revealed that ANG-2 also is critical in lymphangiogenesis during development. ANG-2 has multiple physiologic effects that regulate vascular tone, hormone secretion, tissue growth and neural activity. Several reports indicate that ANG-2 can induce neovascularization in experimental systems due to the expression of different growth factors such as angiopoietin 2, vascular endothelial factor, and its receptor, fibroblast growth factor, platelet derived growth factor, transforming growth factor beta and epidermal growth factor. In addition, ANG-2 is strongly expressed in the vasculature of many tumors and it has been suggested that ANG-2 may act synergistically with other cytokines such as vascular endothelial growth factor to promote tumor-associated Angiogenesis and tumor progression.

  • Thomas M, et al. (2009) The role of the Angiopoietins in vascular morphogenesis. Angiogenesis. 12(2): 125-37.
  • Hu B, et al. (2009) Angiopoietin-2: development of inhibitors for cancer therapy. Curr Oncol Rep. 11(2): 111-6.
  • Fiedler U, et al. (2006) Angiopoietins: a link between angiogenesis and inflammation. Trends Immunol. 27: 552-8.
  • Escobar E, et al. (2004) Angiotensin II, cell proliferation and angiogenesis regulator: biologic and therapeutic implications in cancer. Curr Vasc Pharmacol. 2(4): 385-99.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks