Quick Order

Mouse CD99 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CD99cDNA Clone Product Information
cDNA Size:528
cDNA Description:ORF Clone of Mus musculus CD99 antigen DNA.
Gene Synonym:D4, Pilr-l, pilr-1,
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD99 is a transmembrane protein expressed on most hematopoietic cells, endothelial cells and at the borders between confluent cells. CD99 is also found expressed in the development of normal ovary and testis as well as in 25 sex cord-stromal tumors, 7 epithelial neoplasms, and 6 germ cell tumors. CD99 may be a useful marker for sex cord-stromal tumors and that its degree of reactivity correlates with the degree of differentiation in Sertoli-Leydig cell tumors. Additionally, CD99 might aid in distinguishing granulose cell tumors of the ovary from poorly differentiated carcinomas and it has been reported to be a sensitive and specific marker for Ewing's sarcoma and primitive neuroectodermal tumor.

  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Schenkel AR, et al. (2002) CD99 plays a major role in the migration of monocytes through endothelial junctions. Nature Immunology. 3: 143 - 50.
  • Gordon MD, et al. (1998) CD99, keratin, and vimentin staining of sex cord-stromal tumors, normal ovary, and testis. Mod Pathol. 11 (8): 769-73.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items