Quick Order

Text Size:AAA

Mouse CD209B natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CD209B cDNA Clone Product Information
Gene_bank_ref_id:NM_026972.3
RefSeq ORF Size:978bp
cDNA Description:Full length Clone DNA of Mus musculus CD209b antigen.
Gene Synonym:OtB7, SIGNR1, mSIGNR1, 1810030I22Rik, Cd209b
Species:Mouse
Vector:pCMV3-untagged
Plasmid:pCMV3-mCD209B
Restriction Site:KpnI + XbaI (6.1kb + 0.98kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD209b, also known as SIGNR1, is a C-type lectin receptor. CD209b is present on most regions of mouse brain and found on microglia and dendritic cells but not on neurons or astrocytes. CD209b is implicated in the recently described SIGNR1 complement activation pathway, which operates against capsular polysaccharides in splenic marginal macrophages. CD209b in rat is homologue to SIGNR1 in mouse, both of which are found to mediate the uptake of dextran or CPS14 within the splenic marginal zone.

References
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Park JY, et al. (2009) The C-type lectin CD209b is expressed on microglia and it mediates the uptake of capsular polysaccharides of Streptococcus pneumonia. Neuroscience Letters. 450 (3): 246-51.
  • Size / Price
    Catalog: MG50486-UT
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"