Quick Order

Mouse SIRT5 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse SIRT5 cDNA Clone Product Information
Gene_bank_ref_id:NM_178848.3
RefSeq ORF Size:933bp
cDNA Description:Full length Clone DNA of Mus musculus sirtuin 5 (silent mating type information regulation 2 homolog) 5 (S. cerevisiae).
Gene Synonym:AV001953, 0610012J09Rik, 1500032M05Rik, Sirt5
Species:Mouse
Vector:pCMV3-untagged
Plasmid:pCMV3-mSIRT5
Restriction Site:KpnI + XbaI (6.1kb + 0.93kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 6 A>T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Mouse SIRT5 Gene Plasmid Map
Mouse SIRT5 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Size / Price
Catalog: MG50483-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"