After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse GPNMB Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GPNMBcDNA Clone Product Information
Gene_bank_ref_id:NM_008486.1
cDNA Size:1725
cDNA Description:ORF Clone of Mus musculus glycoprotein (transmembrane) nmb DNA.
Gene Synonym:ipd, Dchil, DC-HIL
Species:Mouse
Vector:pCMV3-untagged
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name
Background

GPNMB belongs to the PMEL / NMB family, also known as Osteoactivin and Hematopoietic growth factor-inducible neurokinin 1 ( HGFIN ), is a transmembrane glycoprotein that is expressed in numerous cells, including osteoclasts, macrophages, dendritic cells, and tumor cells. It is suggested to influence osteoblast maturation, cell adhesion and migration. GPNMB protein acts as a downstream mediator of BMP-2 effects on osteoblast differentiation and function. GPNMB participates in bone mineralization, and functions as a negative regulator of inflammation in macrophages. Osteoactivin is expressed at high levels in normal and inflammatory liver macrophages suggesting a significant role in acute liver injury. The early-phase upregulation of Osteoactivin expression in the tubular epithelium in response to renal injury might play a role in triggering renal interstitial fibrosis via activation of matrix metalloproteinase expression and collagen remodeling in rats. Osteoactivin as a protein that is expressed in aggressive human breast cancers and is capable of promoting breast cancer metastasis to bone.

References
  • Pahl MV. et al., 2010, Clin J Am Soc Nephrol. 5(1): 56-61.
  • Abdelmagid SM. et al., 2008, Exp Cell Res. 314(13): 2334-51.
  • Haralanova-Ilieva B. et al., 2005, J Hepatol. 242(4): 565-72.
  • Abdelmagid SM. et al., 2007, J Cell Physiol. 210(1): 26-37.
  • Furochi H. et al., 2007, J Med Invest. 54(3-4): 248-54.
  • Size / Price
    Catalog:MG50475-UT
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"