After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human chk1 ORF mammalian expression plasmid, C-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CHEK1 cDNA Clone Product Information
Gene_bank_ref_id:NM_001274.2
RefSeq ORF Size:1431bp
cDNA Description:Full length Clone DNA of Homo sapiens CHK1 checkpoint homolog (S. pombe) with C terminal Flag tag.
Gene Synonym:CHK1, CHEK1
Species:Human
Vector:pCMV3-C-FLAG
Plasmid:pCMV3-CHEK1-FLAG
Restriction Site:KpnI + XbaI (6kb + 1.48kb)
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

CHK1 / CHEK1 contains 1 protein kinase domain and belongs to the protein kinase superfamily, CAMK Ser/Thr protein kinase family, NIM1 subfamily. It is a member of checkpoint kinases (Chks). Chks Checkpoint kinases (Chks) are serine/threonine kinases that are involved in the control of the cell cycle. There are two subtypes of chks that have so far been identified, CHK1 / CHEK1 and Chk2. They are essential components to delay cell cycle progression in normal and damaged cells and can act at all three cell cycle checkpoints. Chks are activated by phosphorylation. ATR kinase phosphorylates CHK1 / CHEK1 in response to single strand DNA breaks and ATM kinase phosphorylates Chk2 in response to double strand breaks. Chks phosphorylate Cdc25 phosphatase at Ser216, which leads to Cdc25 sequestration in the cytoplasm. Chks have a role in the physiological stress of hypoxia/reoxygenation. CHK1 / CHEK1 is required for checkpoint mediated cell cycle arrest in response to DNA damage or the presence of unreplicated DNA. CHK1 / CHEK1 may also negatively regulate cell cycle progression during unperturbed cell cycles.

References
  • Chen P, et al. (2000) The 1.7 a crystal structure of human cell cycle checkpoint kinase CHK1 / CHEK1: Implications for CHK1 / CHEK1 regulation. Cell. 100 (6): 681-92.
  • Sanchez Y, et al. (1997) Conservation of the CHK1 / CHEK1 checkpoint pathway in mammals: linkage of DNA damage to Cdk regulation through Cdc25. Science. 277 (5331): 1497-501.
  • Flaggs G, et al. (1998) Atm-dependent interactions of a mammalian CHK1 / CHEK1 homolog with meiotic chromosomes. Curr Biol. 7 (12): 977-86.
  • Chini CC, et al. (2005) Claspin, a regulator of CHK1 / CHEK1 in DNA replication stress pathway. DNA Repair. 3 (8-9): 1033-7.
  • Size / Price
    Catalog: HG10539-CF
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"