Quick Order

Text Size:AAA

Mouse IFNAR1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
IFNAR1cDNA Clone Product Information
cDNA Size:1773
cDNA Description:ORF Clone of Mus musculus interferon (alpha and beta) receptor 1 DNA.
Gene Synonym:Ifar, Ifrc, CD118, Ifnar, Infar, Ifnar1
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Interferon & Receptor Related Products
Product nameProduct name
Mouse IFNA2 / Interferon alpha 2 ProteinCynomolgus IFNAR1 / IFNAR ProteinCynomolgus / Rhesus IFNA2 / Interferon alpha 2 ProteinHuman IL29 / IFNL1 ProteinCynomolgus IFNAR2 / IFNABR Protein (ECD, His Tag)Human Interferon alpha 2 / IFNA2 ProteinMouse IL-28B / IFN-lambda-3 Protein (His Tag)Cynomolgus / Rhesus IFNG / Interferon Gamma ProteinHuman IFNα4 / IFNa4 / Interferon alpha-4 Protein (Fc Tag)Human IFNα4 / IFNa4 / Interferon alpha-4 Protein (His Tag)Human IFNGR1 / CD119 Protein (His & Fc Tag)Human IFNGR1 / CD119 Protein (His Tag)Human Interferon alpha 7 / IFNA7 Protein (Fc Tag)Human IFNA5 / IFNaG / Interferon alpha-G Protein (Fc Tag)Human Interferon alpha-B / IFNA8 ProteinHuman Interferon alpha 10 / IFNA10 Protein (Fc Tag)Human Interferon omega-1 / IFNω / IFNW1 Protein (Fc Tag)Human IFN omega 1 / IFNW1 Protein (His Tag)Human IFNAR2 / IFNABR Protein (Fc Tag)Human IFNAR2 / IFNABR Protein (His Tag)Human Interferon beta / IFN-beta / IFNB Protein (Fc Tag)Human Interferon beta / IFN-beta / IFNB ProteinHuman Interferon alpha-B / IFNA8 Protein (His Tag)Human IFN-gamma / IFNG / γ-IFN ProteinHuman IFNL3 / IL28B / Interleukin-28B Protein (His Tag)Human IL-29 / Interleukin-29 Protein (His Tag)Mouse IFNA5 / IFNaG Protein (His Tag)Human IFNAR1 / IFNAR Protein (Fc Tag)Human IFNAR1 / IFNAR Protein (His Tag)Mouse IFNAR1 / IFNAR Protein (His Tag)Mouse IFNA2 / Interferon alpha 2 Protein (Fc Tag)Mouse IFNA5 / IFNaG Protein (Fc Tag)Mouse IFNG / Interferon Gamma ProteinMouse IFNGR2 Protein (His Tag)Mouse IFNA14 / Interferon alpha-14 Protein (Fc Tag)Mouse IFNA13 / Interferon alpha-13 Protein (Fc Tag)Mouse IFNA4 / Interferon alpha-4 Protein (Fc Tag)Mouse IFNGR1 / CD119 Protein (Fc Tag)Mouse IFNGR1 / CD119 Protein (His Tag)Mouse IFNB1 / IFN-beta / Interferon beta Protein (Fc Tag)Mouse IFNB1 / IFN-beta / Interferon beta ProteinMouse IFNG / Interferon Gamma Protein (Fc Tag)Mouse IFNG / Interferon Gamma Protein (His Tag)Cynomolgus / Rhesus IFNA14 / Interferon alpha-14 Protein (His Tag)Ferret IFNG / Interferon Gamma Protein (His Tag)Rat IFNA4 / IFNα4 / Interferon alpha-4 Protein (Fc Tag)Rat IFN-alpha / IFNA1 / IFN Protein (Fc Tag)Rat IFN-alpha / IFNA1 / IFN Protein (His Tag)Rat IFNGR / IFNGR1 Protein (Fc Tag)Rat IFNA5 / IFNaG Protein (His Tag)Rat IFNG / Interferon Gamma Protein (Fc Tag)Cynomolgus IFNA2 / Interferon alpha 2 Protein (Fc Tag)Cynomolgus IFNA2 / Interferon alpha 2 Protein (His Tag)Cynomolgus Interferon alpha-B / IFNA8 Protein (Fc Tag)Cynomolgus Interferon alpha-B / IFNA8 Protein (His Tag)Cynomolgus IFNA13 / Interferon alpha-13 Protein (Fc Tag)Cynomolgus IFNA13 / Interferon alpha-13 Protein (His Tag)Cynomolgus IFNAR1 / IFNAR Protein (His Tag)Cynomolgus IFNA4 / IFNα4 / Interferon alpha-4 Protein (Fc Tag)Cynomolgus IFNGR / IFNGR1 Protein (Fc Tag)Cynomolgus IFNGR / IFNGR1 Protein (His Tag)Cynomolgus IFN gamma Protein (His Tag)Mouse IFNA14 / Interferon alpha-14 Protein (His Tag)Cynomolgus IFNB1 / IFN-beta / Interferon beta Protein (Fc Tag)Cynomolgus IFNAR1 / IFNAR Protein (Fc Tag)Mouse IFNA13 / Interferon alpha-13 Protein (His Tag)Mouse IFNA4 / IFNα4 / Interferon alpha-4 Protein (His Tag)

Interferon-alpha/beta receptor alpha chain (IFNAR1) is a type I membrane protein that forms one of the two chains of a receptor for interferons alpha and beta. Binding and activation of the receptor stimulates Janus protein kinases, which in turn phosphorylate several proteins, including STAT1 and STAT2. The encoded protein also functions as an antiviral factor. Tyk2 slows down IFNAR1 degradation and that this is due, at least in part, to inhibition of IFNAR1 endocytosis. Mutant versions of IFNAR1, in which Tyr466 is changed to phenylalanine, can act in a dominant negative manner to inhibit phosphorylation of STAT2. These observations are consistent with a model in which IFNAR1 mediates the interaction between JAK kinases and the STAT transcription factors.

  • Yan H, et al. (1996) Phosphorylated interferon-alpha receptor 1 subunit (IFNaR1) acts as a docking site for the latent form of the 113 kDa STAT2 protein. EMBO J. 15(5): 1064-74.
  • Richter MF, et al. (1998) Specific contribution of Tyk2 JH regions to the binding and the expression of the interferon alpha/beta receptor component IFNAR1. J Biol Chem. 273(38): 24723-9.
  • Abramovich C, et al. (1997) A protein-arginine methyltransferase binds to the intracytoplasmic domain of the IFNAR1 chain in the type I interferon receptor. EMBO J. 16(2): 260-6.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items