Quick Order

Text Size:AAA

Human PAPPA2 transcript variant 1 ORF mammalian expression plasmid, C-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PAPPA2 cDNA Clone Product Information
Gene_bank_ref_id:NM_020318.2
RefSeq ORF Size:5376bp
cDNA Description:Full length Clone DNA of Homo sapiens pappalysin 2 , transcript variant 1 with C terminal Flag tag.
Gene Synonym:PAPPE, PLAC3, PAPP-A2
Species:Human
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Pappalysin-2/PAPP-A2 is the second member of the pappalysin family of metzincin superfamily, of which PAPP-A is the first member. There is no homology between the prepro-peptides of PAPP-A and PAPP-A2, but 46% of the residues of mature PAPP-A are also present in mature PAPP-A2. PAPP-A specifically cleaves insulin-like growth factor-binding protein(IGFBP)-4, one of six known modulators of IGF-I and –II, whereas PAPP-A2 specifically cleaved IGFBP-5 at one site, between Ser-143 and Lys-144. In contrast to the cleavage of IGFBP-4 by PAPP-A that strictly requires the presence of IGF, the cleavage of IGFBP-5 by PAPP-A2 was IGF-independent. Recent data firmly establish PAPP-A and IGFBP-4 as an important functional pair in several systems. Because of its close relationship with PAPP-A, both structurally and functionally, PAPP-A2 is a likely candidate for IGFBP-5 proteinase in many tissues and conditioned media where IGFBP-5 proteolysis has been reported.

References
  • Lisbeth S Laursen. et al., 2002, Vol. 277 (49): 47225-34.
  • Michael T Overgaard. et al., 2001, The Journal of Biological Chemistry. 276 (24): 21849-53.
  • Size / Price
    Catalog: HG10528-CF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"