Quick Order

Mouse F11R Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
F11RcDNA Clone Product Information
cDNA Size:903
cDNA Description:ORF Clone of Mus musculus F11 receptor DNA.
Gene Synonym:JAM, Jcam, JAM-1, JAM-A, Jcam1, Ly106, ESTM33, AA638916, 9130004G24, F11r
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 567 T/C not causing the amino acid variation.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name

Junctional adhesion molecule-A (JAM-A), also known as F11 receptor (F11R) or Cluster of Differentiation 321 (CD321), is a transmembrane protein expressed at tight junctions of epithelial and endothelial cells, as well as on circulating leukocytes. JAM-A protein serves as a serotype-independent receptor for mammalian orthoreoviruses (reoviruses). It is also a ligand for the integrin LFA1, involves in leukocyte transmigration. As a cell adhesion molecule of the immunoglobulin superfamily, JAM-A protein involves in platelet adhesion, secretion and aggregation, and plays a crucial role in inflammatory thrombosis and atherosclerosis. In addition, it may be a potential therapeutic target for breast cancer.

  • Guglielmi KM, et al. (2007) Reovirus binding determinants in junctional adhesion molecule-A. J Biol Chem. 282(24): 17930-40.
  • Yeung D, et al. (2008) Decreased junctional adhesion molecule-A expression during blood-brain barrier breakdown. Acta Neuropathol. 115(6): 635-42.
  • Ong KL, et al. (2009) Elevated plasma level of soluble F11 receptor/junctional adhesion molecule-A (F11R/JAM-A) in hypertension. Am J Hypertens. 22(5): 500-5.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 Business days
      Recently Viewed Items