Quick Order

Text Size:AAA

Mouse PTPN11 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PTPN11cDNA Clone Product Information
Gene_bank_ref_id:NM_001109992.1
cDNA Size:1782
cDNA Description:ORF Clone of Mus musculus protein tyrosine phosphatase, non-receptor type 11, transcript variant 2 DNA.
Gene Synonym:Syp, Shp2, PTP1D, PTP2C, SAP-2, SHP-2, SH-PTP2, SH-PTP3
Species:Mouse
Vector:pCMV3-untagged
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Mouse PTPN11 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Mouse PTPN11 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedMG50462-ACG$345
Mouse PTPN11 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagMG50462-ACR$345
Mouse PTPN11 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedMG50462-ANG$345
Mouse PTPN11 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagMG50462-ANR$345
Mouse PTPN11 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedMG50462-CF$315
Mouse PTPN11 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedMG50462-CH$315
Mouse PTPN11 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedMG50462-CM$315
Mouse PTPN11 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedMG50462-CY$315
Mouse PTPN11 transcript variant 2 Gene cDNA Clone (full-length ORF Clone)MG50462-M$115
Mouse PTPN11 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedMG50462-NF$315
Mouse PTPN11 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedMG50462-NH$315
Mouse PTPN11 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedMG50462-NM$315
Mouse PTPN11 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedMG50462-NY$315
Mouse PTPN11 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedMG50462-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

SHP2, also known as PTPN11, belongs to the protein-tyrosine phosphatase(PTP) family, non-receptor class 2 subfamily. PTPs catalyze the removal of phosphate groups from tyrosine residues by the hydrolysis of phosphoric acid monoesters. They dephosphorylate EGFR, JAK2 and TYK2 kinases, promoting oncogenic transformation. SHP2 is widely expressed, with highest levels in heart, brain, and skeletal muscle. SHP2 acts downstream of various receptor and cytoplasmic protein tyrosine kinases to participate in the signal transduction from the cell surface to the nucleus. It also dephosphorylates ROCK2 at Tyr-722 resulting in stimulatation of its RhoA binding activity.

References
  • Ganju R K, et al. (2000) Beta-chemokine receptor CCR5 signals through SHP1, SHP2, and Syk. J Biol Chem. 275(23):17263-8.
  • Yin T, et al. (1997) Molecular characterization of specific interactions between SHP-2 phosphatase and JAK tyrosine kinases. J Biol Chem. 272(2):1032-7.
  • Kontaridis MI, et al. (2006) PTPN11 (Shp2) mutations in LEOPARD syndrome have dominant negative, not activating, effects. J Biol Chem. 281(10):6785-92.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"