Quick Order

Text Size:AAA

Mouse PDGF-C Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PDGFCcDNA Clone Product Information
Gene_bank_ref_id:NM_019971.2
cDNA Size:1038
cDNA Description:ORF Clone of Mus musculus platelet-derived growth factor, C polypeptide DNA.
Gene Synonym:PDGF-C, AI647969, 1110064L01Rik
Species:Mouse
Vector:pCMV3-untagged
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Background

PDGF-C is a member of the PDGF/VEGF family of growth factors with a unique domain organization and expression pattern. Platelet-derived growth factor receptors (PDGFRs) are catalytic receptors that have intracellular tyrosine kinase activity. They have roles in the regulation of many biological processes including embryonic development, angiogenesis, cell proliferation and differentiation, and contribute to the pathophysiology of some diseases, including cancer. There are two isoforms of the PDGFR receptor; PDGFRalpha and PDGFRbeta, which can form homo- or heterodimers. The endogenous PDGFR ligands are PDGF-A, -B, -C and -D, which induce receptor dimerization and transphosphorylation at specific tyrosine residues upon binding. This activates the intracellular kinase activity, initiating intracellular signaling through the MAPK, PI 3-K and PKCgamma pathways. PDGF-C acts as a specific ligand for alpha platelet-derived growth factor receptor homodimer, and alpha and beta heterodimer. Binding of this growth factor to its affinity receptor elicits a variety of cellular responses. PDGF-C Appears to be involved in the three stages of wound healing: inflammation, proliferation and remodeling. Involved in fibrotic processes, in which transformation of interstitial fibroblasts into myofibroblasts plus collagen deposition occurs.

References
  • Li X, et al. (2000) PDGF-C is a new protease-activated ligand for the PDGF alpha-receptor. Nat Cell Biol. 2 (5): 302-9.
  • Ding H, et al. (2004) A specific requirement for PDGF-C in palate formation and PDGFR-alpha signaling. Nat Genet. 36 (10): 1111-6.
  • Choi SJ, et al. (2009) The PDGF-C regulatory region SNP rs28999109 decreases promoter transcriptional activity and is associated with CL/P. European Journal of Human Genetics. 17 (11): 774-84.
  • Size / Price
    Catalog:MG50458-UT
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"