After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human THOP1 ORF mammalian expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Human THOP1 cDNA Clone Product Information
NCBI RefSeq:NM_003249.2
RefSeq ORF Size:2070bp
cDNA Description:Full length Clone DNA of Homo sapiens thimet oligopeptidase 1 with C terminal Flag tag.
Gene Synonym:TOP, MP78, EP24.15, MEPD_HUMAN
Species:Human
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

THOP1, also known as Thimet oligopeptidase 1, Thimet oligopeptidase, EC 3.4.24.15, or EP24.15, is a zinc(II) endopeptidase implicated in the processing of numerous physiological peptides. As an intracellular enzyme, highly expressed in the brain, kidneys and neuroendocrine tissue, THOP1 has been proposed to metabolize peptides within cells, thereby affecting antigen presentation and G protein-coupled receptor signal transduction. Its substrates is gonadotrophin-releasing hormone (GnRH), an important hypothalamic hormone that regulates the synthesis and release of oestradiol and facilitates female sexual behaviour. THOP1 against toxic effects of Abeta in the early stages of Alzheimer disease (AD) pathology, and suggest that the observed increase in THOP1 expression might be part of a compensatory defense mechanism of the brain against an increased Abeta load.

References
  • Cyr NE, et al. (2010) Nuclear Thimet oligopeptidase is coexpressed with oestrogen receptor alpha in hypothalamic cells and regulated by oestradiol in female mice. J Neuroendocrinol. 22(8): 936-43.
  • Berti DA, et al. (2009) Analysis of intracellular substrates and products of thimet oligopeptidase in human embryonic kidney 293 cells. J Biol Chem. 284(21): 14105-16.
  • Russo LC, et al. (2009) Interaction with calmodulin is important for the secretion of thimet oligopeptidase following stimulation. FEBS J. 276(16): 4358-71.
  • Pollio G, et al. (2008) Increased expression of the oligopeptidase THOP1 is a neuroprotective response to Abeta toxicity. Neurobiol Dis. 31(1): 145-58.
  • Bruce LA, et al. (2008) Hydrogen bond residue positioning in the 599-611 loop of thimet oligopeptidase is required for substrate selection. FEBS J. 275(22): 5607-17.
  • Size / Price
    Catalog: HG10512-CF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"