Quick Order

Mouse LGALS8 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse LGALS8 cDNA Clone Product Information
Gene_bank_ref_id:NM_018886.4
RefSeq ORF Size:951bp
cDNA Description:Full length Clone DNA of Mus musculus lectin, galactose binding, soluble 8.
Gene Synonym:Lgals-8, AI326142, D13Ertd524e, 1200015E08Rik, Lgals8
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
References
  • Levy Y, et al. (2003) Sustained induction of ERK, protein kinase B, and p70 S6 kinase regulates cell spreading and formation of F-actin microspikes upon ligation of integrins by galectin-8, a mammalian lectin. J Biol Chem. 278(16):14533-42.
  • Nishi N, et al. (2003) Galectin-8 modulates neutrophil function via interaction with integrin alphaM. Glycobiology. 13(11):755-63.
  • Bidon-Wagner N, et al. (2004) Human galectin-8 isoforms and cancer. Glycoconj J. 19(7-9):557-63.
  • Size / Price
    Catalog: MG50429-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"