Quick Order

Mouse CD36 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CD36cDNA Clone Product Information
cDNA Size:1419
cDNA Description:ORF Clone of Mus musculus CD36 antigen DNA.
Gene Synonym:FAT, GPIV, Scarb3, Cd36
Restriction Site:KpnI + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 6 C>A, 1413 G>T and 1414A>G not causing the amino acid variation.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. Cluster of differentiation 36 (CD36), also known as FAT, SCARB3, GP88, glycoprotein IV (gpIV) and glycoprotein IIIb (gpIIIb), is a member of the CD system as well as the class B scavenger receptor family of cell surface proteins. CD36 can be found on the surface of many cell types in vertebrate animals and it consists of 472 amino acids and is extensively glycosylated. It is an integral membrane protein primarily serving as receptors for thrombospondin and collagen and by the erythrocytes infected with the human malaria parasite. The role of CD36 as a cell surface receptor has been extended to that of a signal transduction molecule.

  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Greenwalt RH, et al. (1992) Membrane glycoprotein in CD36: a review of its roles in adherence, signal transduction, and transfusion medicine. The journal of the American society of hematology. 80 (5): 1105-15.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    • Mouse CD36 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items