After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse FGF21 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse FGF21 cDNA Clone Product Information
Gene_bank_ref_id:NM_020013.4
RefSeq ORF Size:633bp
cDNA Description:Full length Clone DNA of Mus musculus fibroblast growth factor 21.
Gene Synonym:Fgf21
Species:Mouse
Vector:pCMV3-untagged
Plasmid:pCMV3-mFGF21
Restriction Site:HindIII + NotI (6.1kb + 0.63kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Cynomolgus FGF21 / Fibroblast Growth Factor 21 Protein (His Tag)Human / Cynomolgus FGF16 / FGF-16 ProteinHuman FGFR2 / CD332 Protein (ECD, His Tag)Mouse bFGF / FGF2 Protein (His Tag)Cynomolgus / Rhesus FGFR3 / CD333 Protein (His Tag)Human FGFR3 / CD333 Protein (alpha(IIIb), His Tag)Human FGFR2 / CD332 Protein (beta(IIIc), His Tag)Human FGFR3 / CD333 Protein (alpha(IIIb), Fc Tag)Human FGF7 / FGF-7 / KGF Protein (His Tag)Human FGFR2 / CD332 Protein (alpha(IIIb), Fc Tag)Human bFGF / FGF2 ProteinHuman aFGF / FGF1 ProteinHuman FGF9 Protein (Fc Tag)Human FGFR1 / CD331 Protein (His & Fc Tag)Human FGFR4 / FGF Receptor 4 Protein (Fc Tag)Human FGFR4 / FGF Receptor 4 Protein (His & Fc Tag)Human FGFR2 Protein (His & Fc Tag)Mouse FGFR3 / CD333 Protein (His & Fc Tag)Mouse FGFR4 / CD334 Protein (His Tag)Human FGFR1 / CD331 Protein (His Tag)Mouse FGFR4 / CD334 Protein (His & Fc Tag)Human FGF10 / KGF2 ProteinMouse / Rat aFGF / FGF1 ProteinMouse FGFR3 / CD333 Protein (His Tag)Human FGFR2 / CD332 Protein (His Tag)Mouse FGFRL1 / FGFR5 Protein (His Tag)Mouse FGF18 / FGF-18 Protein (His Tag)Mouse FGFR1 / CD331 Protein (His Tag)Mouse FGFR1 / CD331 Protein (Fc Tag)Human FGF21 Protein (His Tag)Human FGFR4 / FGF Receptor 4 Protein (His Tag)Mouse FGF21 / Fibroblast Growth Factor 21 Protein (His Tag)Human FGF18 / FGF-18 Protein (His Tag)Rat FGFR4 / FGF Receptor 4 Protein (Fc Tag)Human FGFR1 / CD331 Protein (His & GST Tag)Human FGF14 / SCA27 Protein (isoform 1B)Human FGFR2 / CD332 Protein (aa 400-821, His & GST Tag)Human FGFBP3 Protein (His Tag)Cynomolgus FGFR3 Protein (Fc Tag)Rat FGFR4 / FGF Receptor 4 Protein (His Tag)Human FGF19 ProteinHuman FGF17 ProteinRhesus FGFR4 / FGF Receptor 4 Protein (Fc Tag)Rhesus FGFR1 / CD331 Protein (Fc Tag)Mouse FGFR2 / CD332 Protein (Fc Tag)Human FGF6 / FGF-6 ProteinMouse FGFR2 / CD332 Protein (His Tag)Human FGFR1OP / FOP Protein (His & GST Tag)Cynomolgus aFGF / FGF1 ProteinCanine FGF12 ProteinCanine aFGF / FGF1 ProteinRhesus FGFR4 / FGF Receptor 4 Protein (His Tag)Rhesus FGFR1 / CD331 Protein (His Tag)Canine FGF14 / SCA27 ProteinCanine FGF9 / FGF-9 Protein (Fc Tag)Human FGFR3 / CD333 Protein (His Tag, ECD)Human FGFR3 / CD333 Protein (Fc Tag, ECD)Mouse FGF7 / FGF-7 / KGF Protein (His Tag)
Background

Fibroblast growth factor 21 (FGF21) is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities and are involved in a variety of biological processes including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. FGF-21 has a hydrophobic amino terminus, which is a typical signal sequence, and appears to be a secreted protein. The metabolic regulator fibroblast growth factor 21 (FGF21) has antidiabetic properties in animal models of diabetes and obesity. FGF21 is a novel adipokine associated with obesity-related metabolic complications in humans. The paradoxical increase of serum FGF21 in obese individuals, which may be explained by a compensatory response or resistance to FGF21, warrants further investigation. FGF-21, which we have identified as a novel metabolic factor, exhibits the therapeutic characteristics necessary for an effective treatment of diabetes.

References
  • Zhang X, et al. (2008) Serum FGF21 levels are increased in obesity and are independently associated with the metabolic syndrome in humans. Diabetes. 57(5): 1246-53.
  • Lundåsen T, et al. (2007) PPARalpha is a key regulator of hepatic FGF21. Biochem Biophys Res Commun. 360(2): 437-40.
  • Kharitonenkov A, et al. (2005) FGF-21 as a novel metabolic regulator. J Clin Invest. 115(6): 1627-35.
  • Size / Price
    Catalog: MG50421-UT
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn StockShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"