After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse LGALS3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific PreferencesReviewsResearch TopicsProtocols
LGALS3cDNA Clone Product Information
Gene Bank Ref.ID:NM_010705.3
cDNA Size:795
cDNA Description:ORF Clone of Mus musculus lectin, galactose binding, soluble 3 DNA.
Gene Synonym:GBP, L-34, gal3, Mac-2, Lgals3
Species:Mouse
Vector:pCMV3-untagged
Restriction Site:KpnI + NotI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 117T/C, 132C/T, 141A/G, 186C/T, 546G/A and 627C/A not causing the amino acid variation.
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name
Reference
  • Dumic J, et al. (2006) Galectin-3: an open-ended story. Biochim Biophys Acta. 1760(4): 616-35.
  • Sharma UC, et al. (2004) Galectin-3 marks activated macrophages in failure-prone hypertrophied hearts and contributes to cardiac dysfunction. Circulation. 110(19): 3121-8.
  • Yan YP, et al. (2009) Galectin-3 mediates post-ischemic tissue remodeling. Brain Res. 1288: 116-24.
  • Size / Price
    Catalog:MG50406-UT
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availsability:5 Business days
    Images
    • Mouse LGALS3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Please note:All products are "FOR RESEARCH UES ONLY AND ARE NOT INTENDED FOR DIAGNOSTICE OFR THERAPEUTIC USE"