After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse GRN natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse GRN cDNA Clone Product Information
Gene_bank_ref_id:NM_008175.4
RefSeq ORF Size:1770bp
cDNA Description:Full length Clone DNA of Mus musculus granulin.
Gene Synonym:epithelin, Grn
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

&Granulins are a family of secreted, glycosylated peptides that are cleaved from a single precursor protein with 7.5 repeats of a highly conserved 12-cysteine granulin/epithelin motif. The precursor protein, progranulin, is also called proepithelin and PC cell-derived growth factor. Cleavage of the signal peptide produces mature granulin which can be further cleaved into a variety of active, 6 kDa peptides. These smaller cleavage products are named granulin A, granulin B, granulin C, etc. Epithelins 1 and 2 are synonymous with granulins A and B, respectively. Both the peptides and intact granulin protein regulate cell growth. However, different members of the granulin protein family may act as inhibitors, stimulators, or have dual actions on cell growth. Granulin family members are important in normal development, wound healing, and tumorigenesis. Granulins have possible cytokine-like activity. They may play a role in inflammation, wound repair, and tissue remodeling. Granulin-4 promotes proliferation of the epithelial cell line A431 in culture while granulin-3 acts as an antagonist to granulin-4, inhibiting the growth. Granulin expression inhibited Tat transactivation, and tethering experiments showed that this effect was due, at least in part, to a direct action on cyclin T1 in the absence of Tat.

References
  • Hoque M, et al. (2003) The growth factor granulin interacts with cyclin T1 and modulates P-TEFb-dependent transcription. Mol Cell Biol. 23(5): 1688-702.
  • Bateman A, et al. (1990) Granulins, a novel class of peptide from leukocytes. Biochem Biophys Res Commun. 173(3): 1161-8.
  • Trinh DP, et al. (1999) Epithelin/granulin growth factors: extracellular cofactors for HIV-1 and HIV-2 Tat proteins. Biochem Biophys Res Commun. 256(2): 299-306.
  • Size / Price
    Catalog: MG50396-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"