After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse SERPINB6A Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SERPINB6cDNA Clone Product Information
Gene_bank_ref_id:NM_009254.3
cDNA Size:1137
cDNA Description:ORF Clone of Mus musculus serine (or cysteine) peptidase inhibitor, clade B, member 6a DNA.
Gene Synonym:Spi3, AI876477, Serpinb6, ovalbumin, 4930482L21Rik, D330015H01Rik, Serpinb6a
Species:Mouse
Vector:pCMV3-untagged
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Mouse SERPINB6A Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Related Products
Product nameProduct name
Background

SerpinB6, also known as Cytoplasmic antiproteinase, Peptidase inhibitor 6, Placental thrombin inhibitor, SERPINB6 and PI-6, is a cytoplasm protein which belongs to the serpin family and Ov-serpin subfamily. SerpinB6 / PI-6 is an inhibitor of cathepsin G, kallikrein-8 and thrombin. It may play an important role in the inner ear in the protection against leakage of lysosomal content during stress and loss of this protection results in cell death and sensorineural hearing loss. SerpinB6 / PI-6 is expressed in keratinocytes (at protein level). It is also found in placenta, cardiac muscle, lung, liver, kidney and pancreas. SerpinB6 / PI-6 is expressed in the inner ear hair cells. It expressed abundantly by normal mast cells in different tissues and by mast cells in mastocytoma lesions. SerpinB6 / PI-6 may be involved in the regulation of serine proteinases present in the brain or extravasated from the blood. Defects in SerpinB6 are the cause of deafness autosomal recessive type 91 which is a form of non-syndromic deafness characterized by progressive and age-dependent sensorineural hearing loss. Vestibular function is normal.

References
  • Morgenstern KA. et al.,1994, Biochemistry. 33: 3432-41.
  • Strik MC. et al., 2004, Blood. 103: 2710-7.
  • Scott FL. et al., 2007, J Biochem. 142: 435-42.
  • Burkard TR. et al., 2011, BMC Syst Biol. 5:17.
  • Size / Price
    Catalog:MG50374-UT
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"