Quick Order

Mouse SERPINB6B natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse SERPINB6B cDNA Clone Product Information
Gene_bank_ref_id:NM_011454.1
RefSeq ORF Size:1134bp
cDNA Description:Full length Clone DNA of Mus musculus serine (or cysteine) peptidase inhibitor, clade B, member 6b.
Gene Synonym:NK13, Spi12, ovalbumin, Serpinb6b
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
References
  • Morgenstern KA, et al. (1994) Complementary DNA cloning and kinetic characterization of a novel intracellular serine proteinase inhibitor: mechanism of action with trypsin and factor Xa as model proteinases. Biochemistry. 33(11): 3432-41.
  • Strik MC, et al. (2004) Intracellular serpin SERPINB6 (PI6) is abundantly expressed by human mast cells and forms complexes with beta-tryptase monomers. Blood.103(7): 2710-7.
  • Scott FL, et al. (2007) SerpinB6 is an inhibitor of kallikrein-8 in keratinocytes. J Biochem. 142(4): 435-42.
  • Size / Price
    Catalog: MG50371-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"