After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse BLK Kinase natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse BLK cDNA Clone Product Information
Gene_bank_ref_id:NM_007549.2
RefSeq ORF Size:1500bp
cDNA Description:Full length Clone DNA of Mus musculus B lymphoid kinase.
Gene Synonym:Blk
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Tyrosine-protein kinase Blk, also known as B lymphocyte kinase, p55-Blk and BLK, is a member of the protein kinase superfamily, Tyr protein kinase family and SRC subfamily. BLK / p55-Blk is expressed in lymphatic organs, pancreatic islets, Leydig cells, striate ducts of salivary glands and hair follicles. BLK / p55-Blk is a src-family protein tyrosine kinase specifically expressed in B-lineage cells of mice. The early onset of Blk expression during B-cell development in the bone marrow and the high expression levels of Blk in mature B cells suggest a possible important role of Blk in B-cell physiology. It is a modulator of beta-cells function, acting through the up-regulation of PDX1 and NKX6-1 and consequent stimulation of insulin secretion in response to glucose. Defects in BLK are a cause of maturity-onset diabetes of the young type 11 which is a form of diabetes that is characterized by an autosomal dominant mode of inheritance, onset in childhood or early adulthood (usually before 25 years of age), a primary defect in insulin secretion and frequent insulin-independence at the beginning of the disease.

References
  • Dymecki,S.M. et al., 1992, J Biol Chem. 267 (7):4815-23.
  • Drebin J.A. et al., 1995, Oncogene 10:477-86.
  • Islam K.B.et al., 1995, J. Immunol. 154:1265-72.
  • Texido,G. et al., 2000, Mol Cell Biol. 20 (4):1227-33.
  • Borowiec M. et al., 2009, Proc. Natl. Acad. Sci. USA. 106: 14460-5.
  • Size / Price
    Catalog: MG50365-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"