Quick Order

Mouse GPR56 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse GPR56 cDNA Clone Product Information
Gene_bank_ref_id:NM_018882.2
RefSeq ORF Size:2064bp
cDNA Description:Full length Clone DNA of Mus musculus G protein-coupled receptor 56.
Gene Synonym:Cyt28, TM7LN4, TM7XN1, Gpr56
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
References
  • Liu M., et al., 1999, Genomics 55: 296-305.
  • Huang,Y. et al., 2008, Mol Cell Biochem. 308 (1-2):133-9.
  • Li,S. et al., 2008, J Neurosci 28 (22):5817-26.
  • Jin,Z. et al., 2009, Prog Mol Biol Transl Sci. 89 :1-13.
  • Xu,L. et al., 2010, Clin Exp Metastasis. 27 (4):241-9.
  • Size / Price
    Catalog: MG50335-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"