Quick Order

Text Size:AAA

Mouse ECM1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ECM1cDNA Clone Product Information
Gene_bank_ref_id:NM_007899.2
cDNA Size:1680
cDNA Description:ORF Clone of Mus musculus extracellular matrix protein 1 DNA.
Gene Synonym:p85, AI663821, Ecm1
Species:Mouse
Vector:pCMV3-untagged
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name
Background

Extracellular matrix protein 1 (ECM1) is a secreted glycoprotein and playing a pivotal role in endochondral bone formation, angiogenesis, and tumour biology. Three splice variants have been identified: ECM1a (540 aa) is most widely expressed, with highest expression in the placenta and heart; ECM1b (415 aa) is differentiation-dependent expressed and found only in tonsil and associated with suprabasal keratinocytes; ECM1c (559 aa) accounts for approximately 15% of skin ECM1. Although ECM1 is not tumor specific, is significantly elevated in many malignant epithelial tumors and is suggested as a possible trigger for angiogenesis, tumor progression and malignancies. It also has been shown to regulate endochondral bone formation, skeletal development and tissue remodeling. 

References
  • Oyama N, et al. (2003) Autoantibodies to extracellular matrix protein 1 in lichen sclerosus. Lancet. 362(9378): 118-23.
  • Chan I, et al. (2004) Rapid diagnosis of lipoid proteinosis using an anti-extracellular matrix protein 1 (ECM1) antibody. J Dermatol Sci. 35(2): 151-3.
  • Lupo I, et al. (2005) A novel mutation of the extracellular matrix protein 1 gene (ECM1) in a patient with lipoid proteinosis (Urbach-Wiethe disease) from Sicily. Br J Dermatol. 153(5): 1019-22.
  • Sander CS, et al. (2006) Expression of extracellular matrix protein 1 (ECM1) in human skin is decreased by age and increased upon ultraviolet exposure. Br J Dermatol. 154(2): 218-24.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"