After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CES2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CES2cDNA Clone Product Information
cDNA Size:1872
cDNA Description:ORF Clone of Homo sapiens carboxylesterase 2 (intestine, liver) DNA.
Gene Synonym:iCE, CE-2, PCE-2, CES2A1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human CES2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged on other vectors
Human CES2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10380-ACG$345
Human CES2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10380-ACR$345
Human CES2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10380-ANG$345
Human CES2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10380-ANR$345
Human CES2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10380-CF$315
Human CES2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10380-CH$315
Human CES2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10380-CM$315
Human CES2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10380-CY$315
Human CES2 Gene cDNA Clone (full-length ORF Clone)HG10380-M$195
Human CES2 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10380-M-F$395
Human CES2 Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10380-M-N$395
Human CES2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10380-NF$315
Human CES2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10380-NH$315
Human CES2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10380-NM$315
Human CES2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10380-NY$315
Human CES2 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10380-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name

Carboxylesterase 2 (CES2) is a member of the carboxylesterase family and belongs to the multigene family. Carboxylesterase 2 is responsible for the hydrolysis of ester- and amide-bond-containing drugs such as cocaine and beroin. It also serves to hydrolyze long-chain fatty acid esters and thioesters. It is speculated that carboxylesterases may play a role in lipid metabolism and the blood-brain barrier system and together with isform 1, are a serine esterase involved in both drug metabolism and activation. Human carboxylesterase 2 is commonly expressed in tumor tissues and irinotecan, a topoisomerase I inhibitor commonly used in the treatment of many solid tumors.

  • Imai T. et al. (2006) Human carboxylesterase isozymes: catalytic properties and rational drug design. Drug metab pharmacokinet. 21 (3): 173-85.
  • Guang Xu, et al. (2002) Human carboxylesterase 2 is commonly expressed in tumor tissue and is correlated with activation of irinotecan. Clin Cancer Res. 8: 2605.
  • Zhang, et al. (2002) Comprehensive Evaluation of Carboxylesterase-2 Expression in Normal Human Tissues Using Tissue Array Analysis. Applied Immunohistochemistry & Molecular Morphology. 10 (4): 374-80.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items