Quick Order

Human CSF3R / CD114 / G-CSFR transcript variant 1 ORF mammalian expression plasmid, C-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CSF3R cDNA Clone Product Information
NCBI RefSeq:NM_000760.2
RefSeq ORF Size:2511bp
cDNA Description:Full length Clone DNA of Homo sapiens colony stimulating factor 3 receptor (granulocyte), transcript variant 1 with C terminal Flag tag.
Gene Synonym:CSF3R, CD114, GCSFR
Species:Human
Vector:pCMV3-C-FLAG
Plasmid:pCMV3-CSF3R-FLAG
Restriction Site:KpnI + XbaI (6kb + 2.56kb)
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human CSF3R Gene Plasmid Map
Human CSF3R / CD114 / G-CSFR transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human CSF3R / CD114 / G-CSFR transcript variant 1 ORF mammalian expression plasmid, C-Flag tag on other vectors
Product nameProduct name
Human M-CSF / CSF-1 ProteinCynomolgus / Rhesus M-CSF / CSF-1 Protein (Fc Tag)Cynomolgus / Rhesus M-CSF / CSF-1 Protein (His Tag)Human M-CSF / CSF-1 Protein (His Tag)Human G-CSF / CSF3 Protein (isoform b)Mouse M-CSF / CSF-1 ProteinHuman M-CSF / CSF-1 Protein (His Tag)Human GM-CSF / CSF2 Protein (Fc Tag)Human G-CSF / CSF3 Protein (Fc Tag)Human G-CSFR / CD114 / CSF3R Protein (Fc Tag)Human G-CSFR / CD114 / CSF3R ProteinHuman CSF2RA / GM-CSFR / CD116 Protein (Fc Tag)Human CSF1R / MCSF Receptor / CD115 Protein (His & Fc Tag)Human CSF1R / MCSF Receptor / CD115 ProteinHuman CSF1R / MCSF Receptor / CD115 Protein (His Tag)Human CSF2RA / GM-CSFR / CD116 Protein (His Tag)Human CD131 / CSF2RB / IL3RB / IL5RB Protein (His Tag)Mouse CSF1R / MCSF Receptor / CD115 Protein (His Tag)Human / Cynomolgus M-CSF / CSF-1 Protein (His Tag)Human G-CSFR / CD114 Protein (His Tag)Human GM-CSF / CSF2 Protein (His Tag)Human G-CSF / CSF3 Protein (isoform b)Human CSF1R / MCSF Receptor / CD115 Protein (His & GST Tag)Human CSF1R / MCSF Receptor / CD115 Protein (aa 543-922, His & GST Tag)Mouse CSF1R / MCSF Receptor / CD115 Protein (His & Fc Tag)Rat CD131 / CSF2RB / IL3RB / IL5RB Protein (Fc Tag)Mouse M-CSF / CSF-1 Protein (His Tag)Mouse GM-CSF / CSF2 Protein (Fc Tag)Mouse GM-CSF / CSF2 Protein (His Tag)Rat GM-CSF / CSF2 Protein (His Tag)Rat CSF1R / MCSF Receptor / CD115 Protein (His Tag)Human GM-CSF / CSF2 ProteinHuman GM-CSF / CSF2 ProteinRat CSF1R / MCSF Receptor / CD115 Protein (Fc Tag)Rat GM-CSF / CSF2 Protein (Fc Tag)Mouse GM-CSF / CSF2 ProteinHuman M-CSF / CSF-1 Protein (Fc Tag)
Background

Granulocyte Colony Stimulating Factor Receptor (G-CSFR), also known as CD114, which belongs to the cytokine receptor superfamily, is a cell surface receptor for colony stimulating factor 3 (CSF3). It is a critical regulator of granulopoiesis. This type I membrane protein has a composite structure consisting of an immunoglobulin(Ig)-like domain, a cytokine receptor-homologous (CRH) domain and three fibronectin type III (FNIII) domains in the extracellular region. Mutations in the G-CSF receptor leading to carboxy-terminal truncation transduce hyperproliferative growth responses, and are implicated in the pathological progression of severe congenital neutropenia (SCN) to acute myelogenous leukemia (AML). Additionally, autocrine/paracrine stimulation of G-CSFR may be important in the biology of solid tumors, including metastasis.

References
  • Kasper B, et al. (1999) Association of src-kinase Lyn and non-src-kinase Syk with the granulocyte colony-stimulating factor receptor (G-CSFR) is not abrogated in neutrophils from severe congenital neutropenia patients with point mutations in the G-CSFR mRNA. Int J Hematol. 70(4): 241-7.
  • Hollenstein U, et al. (2000) Endotoxin down-modulates granulocyte colony-stimulating factor receptor (CD114) on human neutrophils. J Infect Dis. 182(1): 343-6.
  • Kindwall-Keller TL, et al. (2008) Role of the proteasome in modulating native G-CSFR expression. Cytokine. 43(2): 114-23.
  • Beel K, et al. (2009) G-CSF receptor (CSF3R) mutations in X-linked neutropenia evolving to acute myeloid leukemia or myelodysplasia. Haematologica. 94(10): 1449-52.
  •  

    G-CSFR/CD114 related areas, pathways, and other information

    Size / Price
    Catalog: HG10218-CF
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"