Quick Order

Mouse CXCL14 / BRAK natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CXCL14 cDNA Clone Product Information
Gene_bank_ref_id:NM_019568.2
RefSeq ORF Size:300bp
cDNA Description:Full length Clone DNA of Mus musculus chemokine (C-X-C motif) ligand 14.
Gene Synonym:KS1, Kec, BMAC, BRAK, NJAC, MIP-2g, Scyb14, AI414372, MGC90667, bolekine, MIP2gamma, 1110031L23Rik, 1200006I23Rik, Cxcl14
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Size / Price
Catalog: MG50141-UT
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"