Quick Order

Text Size:AAA

Human E-Cadherin ORF mammalian expression plasmid, C-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CDH1 cDNA Clone Product Information
Gene_bank_ref_id:NM_004360.3
RefSeq ORF Size:2649bp
cDNA Description:Full length Clone DNA of Homo sapiens cadherin 1, type 1, E-cadherin (epithelial) (CDH1) with C terminal Flag tag.
Gene Synonym:CDH1, UVO, CDHE, ECAD, LCAM, Arc-1, CD324
Species:Human
Vector:pCMV3-C-FLAG
Plasmid:pCMV3-CDH1-Flag
Restriction Site:HindIII + XbaI (6kb + 2.7kb)
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 2076 T/C not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Cadherins are calcium-dependent cell adhesion proteins which preferentially interact with themselves in a homophilic manner in connecting cells, and thus may contribute to the sorting of heterogeneous cell type. E-cadherin (E-Cad), also known as CDH1 and CD324, is a calcium-dependent cell adhesion molecule the intact function of which is crucial for the establishment and maintenance of epithelial tissue polarity and structural integrity. Mutations in CDH1 occur in diffuse type gastric cancer, lobular breast cancer, and endometrial cancer. In human cancers, partial or complete loss of E-cadherin expression correlates with malignancy. During apoptosis or with calcium influx, E-Cad is cleaved by the metalloproteinase to produce fragments of about 38 kDa (E-CAD/CTF1), 33 kDa (E-CAD/CTF2) and 29 kDa (E-CAD/CTF3), respectively. E-Cad has been identified as a potent invasive suppressor, as downregulation of E-cadherin expression is involved in dysfunction of the cell-cell adhesion system, and often correlates with strong invasive potential and poor prognosis of human carcinomas.

References
  • Wang HD, et al. (2004) CDH1 germline mutation in hereditary gastric carcinoma. World J Gastroenterol. 10(21): 3088-93.
  • Masterson J, et al. (2007) Posttranslational truncation of E-cadherin and significance for tumour progression. Cells Tissues Organs. 185(1-3): 175-9.
  • Mrgineanu E, et al. (2008) Correlation between E-cadherin abnormal expressions in different types of cancer and the process of metastasis. Rev Med Chir Soc Med Nat Iasi. 112(2): 432-6.
  • Size / Price
    Catalog: HG10204-CF
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"