Quick Order

Human Bcl-2 / BCL2 transcript variant alpha Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
BCL2cDNA Clone Product Information
cDNA Size:759
cDNA Description:ORF Clone of Homo sapiens B-cell CLL/lymphoma 2, nuclear gene encoding mitochondrial protein, transcript variant alpha DNA.
Gene Synonym:BCL2
Restriction Site:KpnI + XbaI
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human Bcl-2 / BCL2 transcript variant alpha Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged on other vectors
Human Bcl-2 / BCL2 transcript variant alpha Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10195-ACG$325
Human Bcl-2 / BCL2 transcript variant alpha Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10195-ACR$325
Human Bcl-2 / BCL2 transcript variant alpha Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10195-ANG$325
Human Bcl-2 / BCL2 transcript variant alpha Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10195-ANR$325
Human Bcl-2 / BCL2 transcript variant alpha Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10195-CF$295
Human Bcl-2 / BCL2 transcript variant alpha Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10195-CH$295
Human Bcl-2 / BCL2 transcript variant alpha Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10195-CM$295
Human Bcl-2 / BCL2 transcript variant alpha Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10195-CY$295
Human Bcl-2 / BCL2 transcript variant alpha Gene cDNA Clone (full-length ORF Clone)HG10195-M$95
Human Bcl-2 / BCL2 transcript variant alpha Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10195-NF$295
Human Bcl-2 / BCL2 transcript variant alpha Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10195-NH$295
Human Bcl-2 / BCL2 transcript variant alpha Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10195-NM$295
Human Bcl-2 / BCL2 transcript variant alpha Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10195-NY$295
Human Bcl-2 / BCL2 transcript variant alpha Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10195-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

BCL2 (B-cell leukemia/lymphoma 2, N-Histidine-tagged), also known as Bcl-2, belongs to the Bcl-2 family. Bcl-2 family proteins regulate and contribute to programmed cell death or apoptosis. It is a large protein family and all members contain at least one of four BH (bcl-2 homology) domains. Certain members such as Bcl-2, Bcl-xl and Mcl1 are anti-apoptotic, whilst others are pro-apoptotic. Most Bcl-2 family members contain a C-terminal transmembrane domain that functions to target these proteins to the outer mitochondrial and other intracellular membranes. It is expressed in a variety of tissues. BCL2 blocks the apoptotic death of some cells such as lymphocytes. It also regulates cell death by controlling the mitochondrial membrane permeability and inhibits caspase activity either by preventing the release of cytochrome c from the mitochondria and/or by binding to the apoptosis-activating factor. Constitutive expression of BCL2, such as in the case of translocation of BCL2 to Ig heavy chain locus, is thought to be the cause of follicular lymphoma. Two transcript variants, produced by alternate splicing, differ in their C-terminal ends.

  • Tsujimoto Y, et al. (1984) Cloning of the chromosome breakpoint of neoplastic B cells with the t(14;18) chromosome translocation. Science. 226(4678):1097-99.
  • Cleary ML, et al. (1986) Cloning and structural analysis of cDNAs for bcl-2 and a hybrid bcl-2/immunoglobulin transcript resulting from the t(14;18) translocation. Cell. 47(1):19-28.
  • Otake Y, et al. (2007) Overexpression of nucleolin in chronic lymphocytic leukemia cells induces stabilization of Bcl-2 / Bcl-2 mRNA. Blood. 109(7):3069-75.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 Business days
    • Human Bcl-2 / BCL2 transcript variant alpha Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged
    Recently Viewed Items