After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse SIGIRR natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse SIGIRR cDNA Clone Product Information
NCBI RefSeq:NM_023059.3
RefSeq ORF Size:1230bp
cDNA Description:Full length Clone DNA of Mus musculus single immunoglobulin and toll-interleukin 1 receptor (TIR) domain.
Gene Synonym:TIR8, AI256711, MGC102426
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Human IL18 / IL-18 ProteinCanine IL18R1 Protein (ECD, His Tag)Human IL1RL2 / IL-1Rrp2 Protein (Fc Tag)Cynomolgus IL18R1 Protein (His Tag)Mouse IL18RAP / IL1R7 Protein (His Tag)Sus scrofa (Pig) IL1B / IL-1 beta ProteinHuman IL1RL2 / IL-1Rrp2 Protein (His Tag)Human IL18BPa Protein (His & Fc Tag)Human IL18BPa Protein (His Tag)Human IL1F5 / IL36RN ProteinHuman IL1R2 / CD121b Protein (Fc Tag)Human IL1RL1 / DER4 Protein (Fc Tag)Human IL1RL1 / DER4 ProteinHuman IL-1R9 / IL1RAPL2 Protein (Fc Tag)Human IL-1RA / IL1RN Protein (Fc Tag)Human IL-1RA / IL1RN ProteinHuman IL-1 alpha / IL1A / IL1F1 ProteinHuman IL33 / Interleukin-33 / NF-HEV ProteinMouse IL-18R1 Protein (His & Fc Tag)Human IL-1R8 / IL1RAPL1 Protein (Fc Tag)Human p38 alpha / MAPK14 Protein (His Tag)Mouse SIGIRR / TIR8 Protein (His & Fc Tag)Human IL-1R8 / IL1RAPL1 Protein (His Tag)Human IL-1RAcP / IL-1R3 Protein (His & Fc Tag)Human IL1R1 / CD121a Protein (Fc Tag)Human IL1R1 / CD121a Protein (His Tag)Human IL-1 beta / IL1B ProteinMouse IL18BP Protein (His Tag)Human JNK1 / MAPK8 Protein (GST Tag)Human JNK2 / MAPK9 Protein (His Tag)Human IL18RAP / IL1R7 Protein (Fc Tag)Human IL18R1 / CD218a Protein (His Tag)Human IL-1RAcP / IL-1R3 Protein (His Tag)Human IL18R1 / CD218a Protein (His & Fc Tag)Human ERK2 / MAPK1 / MAPK2 Protein (GST Tag)Human IL1RL1 / ST2 Protein (His Tag)Human IL1R2 / IL1RB / CD121b Protein (His Tag)Mouse IL18R1 / CD218a Protein (His Tag)Human IL18RAP / IL1R7 Protein (His Tag)Human IKB alpha / NFKBIA Protein (His Tag)Mouse IL-1 alpha / IL1A / IL1F1 ProteinHuman IL-1R9 / IL1RAPL2 Protein (His Tag)Rat IL-1 beta / IL1B Protein (pro form, His Tag)Human SIGIRR / TIR8 Protein (His Tag)Rhesus IL-18 / IL-1F4 Protein (His Tag)Mouse IL-1F6 / IL-1 epsilon ProteinHuman IL-1 beta / IL1B Protein (pro form, His Tag)Rat IL1R1 / CD121a Protein (His Tag)Human MARK3 / CTAK1 / EMK-2 Protein (His & GST Tag)Mouse IL-1 beta / IL1B ProteinRat IL1R1 / CD121a Protein (His & Fc Tag)Human IL1RL1 / ST2 Protein (isoform a, His Tag)Human p38 delta / MAPK13 Protein (GST Tag)Human MKK6 / MEK6 / MAP2K6 Protein (His & GST Tag)Mouse MKK4 / MEK4 / MAP2K4 Protein (His & GST Tag)Rat IL-1 beta / IL1B Protein (mature form)Mouse IL1R1 / CD121a Protein (His Tag)Human RELA / Transcription factor p65 / NFkB p65 Protein (aa 1-306, GST Tag)Feline IL1B / IL-1 beta ProteinCynomolgus IL-1 beta / IL1B ProteinHuman IL36B / IL1F8 ProteinHuman IL1F6 / IL36A ProteinMouse IL-1R8 / IL1RAPL1 Protein (Fc Tag)Canine IL-1 beta / IL1B ProteinHuman IL36G / IL1F9 ProteinMouse IL1F8 / IL36b ProteinHuman IL37 / IL1F7 / IL-1H4 ProteinMouse IL1R1 / CD121a Protein (Fc Tag)Human MKK6 / MEK6 / MAP2K6 Protein (207 Ser/Asp, 211 Thr/Asp, His & GST Tag)Canine IL33 / Interleukin-33 / NF-HEV ProteinHuman IL36B / IL1F8 Protein (His Tag)Human IL1F6 / IL36A Protein (His Tag)Mouse ERK2 / MAPK1 / MAPK2 Protein (His & GST Tag)Rat IL18R1 Protein (Fc Tag)Rat IL1R2 / IL1RB / CD121b Protein (His Tag)Human IL36G / IL1F9 Protein (aa 18-169, His Tag)Human p38 delta / MAPK13 Protein (Activated in vitro, GST Tag)Human IL36G / IL1F9 Protein (aa 18-169)Human IL1F6 / IL36 Protein (aa 6-158)Human p38 alpha / MAPK14 Protein (His Tag)Mouse IL1R2 / CD121b Protein (Fc Tag)Mouse IL1R2 / CD121b Protein (His Tag)Rat IL-1RA / IL1RN Protein (Fc Tag)Rhesus IL18RAP Protein (Fc Tag)Rhesus IL18RAP Protein (His Tag)Cynomolgus IL1R2 / IL1RB Protein (Fc Tag)Mouse IL18 / IL-18 ProteinHuman pro form of IL18 / Interleukin 18 / IGIF Protein (GST Tag)(Inactive)Human IL1R1 / CD121a ProteinHuman MKK6 / MEK6 / MAP2K6 ProteinHuman MKK6 / MEK6 / MAP2K6 Protein (207 Asp, 211 Asp)Mouse ERK2 / MAPK1 / MAPK2 ProteinHuman IL1R2 / IL1RB / CD121b ProteinMouse IL1RL1 / ST2 Protein (Fc Tag)Human SIGIRR / TIR8 Protein (Fc Tag)Cynomolgus IL1R1 Protein (Fc Tag)Cynomolgus IL1R1 Protein (His Tag)Canine IL18R1 Protein (Fc Tag)Canine IL1R2 / IL1RB Protein (Fc Tag)Rat IL18R1 Protein (His Tag)Mouse IL36G / IL1F9 Protein (His Tag)Cynomolgus IL18R1 Protein (Fc Tag)Rabbit IL-1 beta / IL1B ProteinMouse IL1RL1 / ST2 Protein (His Tag)Human IL1F10 / IL-38 Protein (His Tag)
Background

Single Ig IL-1-related receptor (SIGIRR) or TIR8 is a member of Toll-like receptor-interleukin 1 receptor signaling (TLR-IL-1R) receptor superfamily. Although SIGIRR/TIR8 shows the typical conserved motifs that characterize the IL-1R and Toll superfamily, it is structurally and functionally distinct from both. SIGIRR/TIR8 has only one Ig domain in its extracellular portion whereas the IL-1R family contains three Ig folds. An unusually long cytoplasmic domain is reminiscent of the structure of drosophila Toll, yet the SIGIRR peptide sequence is more closely related to IL-1RI. SIGIRR/TIR8 was mainly expressed in mouse and human epithelial tissues such as kidney, lung and gut. Resting and activated T and B lymphocytes and monocytes-macrophages expressed little or no SIGIRR/TIR8, with the exception of the mouse GG2EE macrophage line. Inflammation is enhanced in SIGIRR-deficient mice. SIGIRR negatively modulates immune responses. Inflammation is enhanced in SIGIRR-deficient mice, as shown by their enhanced chemokine induction after IL-1 injection and reduced threshold for lethal endotoxin challenge.

References
  • Wald D, et al. (2003) SIGIRR, a negative regulator of Toll-like receptor-interleukin 1 receptor signaling. Nat Immunol. 4(9): 920-7.
  • Polentarutti N, et al. (2003) Unique pattern of expression and inhibition of IL-1 signaling by the IL-1 receptor family member TIR8/SIGIRR. Eur Cytokine Netw. 14(4): 211-8.
  • Wald D, et al. (2003) SIGIRR, a negative regulator of Toll-like receptor-interleukin 1 receptor signaling. Nat Immunol. 4(9): 920-7.
  • Size / Price
    Catalog: MG50122-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"