Quick Order

Human S100A4 transcript variant 1 ORF mammalian expression plasmid, C-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human S100A4 cDNA Clone Product Information
Gene_bank_ref_id:NM_002961.2
RefSeq ORF Size:306bp
cDNA Description:Full length Clone DNA of Homo sapiens S100 calcium binding protein A4, transcript variant 1 with C terminal Flag tag.
Gene Synonym:S100A4, 42A, 18A2, CAPL, FSP1, MTS1, P9KA, PEL98
Species:Human
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human S100A4 transcript variant 1 ORF mammalian expression plasmid, C-Flag tag on other vectors
Human S100A4 transcript variant 1 ORF mammalian expression plasmid, C-GFPSpark tagHG10185-ACG$325
Human S100A4 transcript variant 1 ORF mammalian expression plasmid, C-OFPSpark / RFP tagHG10185-ACR$325
Human S100A4 transcript variant 1 ORF mammalian expression plasmid, N-GFPSpark tagHG10185-ANG$325
Human S100A4 transcript variant 1 ORF mammalian expression plasmid, N-OFPSpark / RFP tagHG10185-ANR$325
Human S100A4 transcript variant 1 ORF mammalian expression plasmid, C-Flag tagHG10185-CF$295
Human S100A4 transcript variant 1 ORF mammalian expression plasmid, C-His tagHG10185-CH$295
Human S100A4 transcript variant 1 ORF mammalian expression plasmid, C-Myc tagHG10185-CM$295
Human S100A4 transcript variant 1 ORF mammalian expression plasmid, C-HA tagHG10185-CY$295
Human S100A4 transcript variant 1 Gene cDNA clone plasmidHG10185-M$95
Human S100A4 transcript variant 1 ORF mammalian expression plasmid, Flag tagHG10185-M-F$295
Human S100A4 transcript variant 1 natural ORF mammalian expression plasmidHG10185-M-N$295
Human S100A4 transcript variant 1 ORF mammalian expression plasmid, N-Flag tagHG10185-NF$295
Human S100A4 transcript variant 1 ORF mammalian expression plasmid, N-His tagHG10185-NH$295
Human S100A4 transcript variant 1 ORF mammalian expression plasmid, N-Myc tagHG10185-NM$295
Human S100A4 transcript variant 1 ORF mammalian expression plasmid, N-HA tagHG10185-NY$295
Human S100A4 transcript variant 1 natural ORF mammalian expression plasmidHG10185-UT$295
 Learn more about expression Vectors
Product nameProduct name
Background

S100A4, also known as metastasis-associated protein Mtsl, belongs to the family of small calcium-binding S100 proteins containing two EF-hand calcium-binding motifs. In humans at least 20 S100 family members that are distributed tissue specifically have been identified, and are involved in a number of cellular processes as transducers of calcium signal. S100A4 is a symmetric homodimer, and undergoes a relatively large conformational change upon the typical EF-hand binding calcium, which is necessary for S100A4 to interact with its protein targets and generate biological effects. It can bind the already known targets p53, F-actin, liprin β, myosin heavy chain II, and prevent their phosphorylation and multimerization. It has been demonstrated that S100A4 is directly involved in tumor metastasis including cell motility, invasion, apoptosis, angiogenesis and differentiation, and appears to be a metastasis factor and a molecular marker for clinical prognosis. Multiple alternatively spliced variants encoding the same protein have been identified.

References
  • Ambartsumian N. et al., 1995, Gene. 159: 125-30.
  • Marenholz I. et al., 2004, Biochem Biophys Res Commun. 322: 1111-22.
  • Helfman DM. et al., 2005, Br J Cancer. 92: 1955-8.
  • Saleem M. et al., 2006, Proc Natl Acad Sci. 103: 14825-30.
  • Boye K. et al., 2008, Int J Cancer. 123: 1301-10.
  • Garrett SC. et al., 2006, J Biol Chem. 281: 677-80.
  • Kriajevska M. et al., 2002, J Biol Chem. 277: 5299-335.
  • Size / Price
    Catalog: HG10185-CF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"