After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse PIGR Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PIGRcDNA Clone Product Information
cDNA Size:2316
cDNA Description:ORF Clone of Mus musculus polymeric immunoglobulin receptor DNA.
Gene Synonym:PIGR
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name

Polymeric immunoglobulin receptor, also known as PIGR, is a member of the immunoglobulin superfamily and a Fc receptor. The ectodomain of this receptor consists of five units with homology to the variable units of immunoglobulins and a transmembrane region, which also has some homology to certain immunoglobulin variable regions. PIGR is expressed on several glandular epithelia including those of liver and breast. The deduced amino-acid sequence has a length of 764 residues and shows an overall similarity of 56% and 64% with the rabbit and rat counterpart. PIGR mediates transcellular transport of polymeric immunoglobulin molecules, and thus facilitates the secretion of IgA and IgM. During this process, a cleavage occurs that separates the extracellular (known as the secretory component) from the transmembrane segment of PIGR.

  • Coyne, R. S. et al., 1995, J. Biol. Chem. 269 (50) :31620-31625. 
  • Kaetzel,C.S., 2001,  Curr Biol. 11(1): R35-38.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items