Quick Order

Human CystatinF ORF mammalian expression plasmid, C-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CST7 cDNA Clone Product Information
Gene_bank_ref_id:NM_003650.2
RefSeq ORF Size:504bp
cDNA Description:Full length Clone DNA of Homo sapiens cystatin F (leukocystatin) with C terminal Flag tag.
Gene Synonym:CST7, CMAP
Species:Human
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

The cystatin superfamily members are important natural cysteine protease inhibitors present in a wide variety of organisms and are divided into three classes. Cystatin F, also known as leukocystatin and CMAP (Cystatin-like Metastasis-Associated Protein), is a type 2 cystatin and its expression is limited to hematopoietic cells, with the highest expression levels being observed in monocytes, dendritic cells, and certain types of T-cells. Furthermore, cystatin F mRNA becomes up-regulated during dendritic cell maturation, and thus suggests a specific role of cystatin F in immune regulation. Cystatin F is produced as a dimer, an inactive cathepsin inhibitor which is activated by chemical reduction. In addition, Cystatin F and its homologues have been observed expressing in various human cancer cell lines established from malignant tumors, and thus indicates a new diagnosis and prevention approach of certain human carcinomas metastasis.

Size / Price
Catalog: HG10167-CF
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"