After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse CD28 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CD28 cDNA Clone Product Information
Gene_bank_ref_id:NM_007642.4
RefSeq ORF Size:657bp
cDNA Description:Full length Clone DNA of Mus musculus CD28 antigen.
Gene Synonym:Cd28
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

CD28 (Cluster of Differentiation 28) is a disulphide-bonded glycoprotein belonging to the immunoglobulin (Ig) superfamily, and structurally consists of a single Ig V-like extracellular domain, a transmembrane domain and an intracellular domain. Mouse CD28 is constitutively expressed on the surface of all murine T cells and on developing thymocytes as disulfide-linked homodimers or as monomers. CD28 can binds the B7-1 and B7-2 ligand, and together perform important functions in the T and B cell response pathways. B7/CD28 family members, which can augment or antagonize T-cell receptor signaling, in the regulation of central and peripheral T-cell tolerance. CD28 is thus involved in T-cell activation, the induction of cell proliferation and cytokine production and promotion of T-cell survival.

References
  • Keir ME, et al. (2005) The B7/CD28 costimulatory family in autoimmunity. Immunol Rev. 204: 128-43.
  • Sansom DM, et al. (2006) The role of CD28 and cytotoxic T-lymphocyte antigen-4 (CTLA-4) in regulatory T-cell biology. Immunol Rev. 212: 131-48.
  • Bjrgo E, et al. (2010) Novel mechanism of signaling by CD28. Immunol Lett. 129(1): 1-6.
  • Size / Price
    Catalog: MG50103-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"