After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human CD221 / IGF1R Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
IGF1RcDNA Clone Product Information
cDNA Size:4143
cDNA Description:ORF Clone of Homo sapiens insulin-like growth factor 1 receptor DNA.
Gene Synonym:IGF1R, CD221, IGFIR, JTK13, MGC18216, MGC142170, MGC142172
Restriction Site:KpnI(Two) + XbaI
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human CD221 / IGF1R Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged on other vectors

The insulin-like growth factor-1 receptor (IGF1R) is a transmembrane tyrosine kinase involved in several biological processes including cell proliferation, differentiation, DNA repair, and cell survival. This a disulfide-linked heterotetrameric transmembrane protein consisting of two α and two β subunits, and among which, the α subunit is extracellular while the β subunit has an extracellular domain, a transmembrane domain and a cytoplasmic tyrosine kinase domain. IGF1R signalling pathway is activated in the mammalian nervous system from early developmental stages. Its major effect on developing neural cells is to promote their growth and survival. This pathway can integrate its action with signalling pathways of growth and morphogenetic factors that induce cell fate specification and selective expansion of specified neural cell subsets. Modulation of cell migration is another possible role that IGF1R activation may play in neurogenesis. In the mature brain, IGF-I binding sites have been found in different regions of the brain, and multiple reports confirmed a strong neuroprotective action of the IGF-IR against different pro-apoptotic insults. IGF1R is an important signaling molecule in cancer cells and plays an essential role in the establishment and maintenance of the transformed phenotype. Inhibition of IGF1R signaling thus appears to be a promising strategy to interfere with the growth and survival of cancer cells. IGF1R is frequently overexpressed by tumours, and mediates proliferation and apoptosis protection. IGF signalling also influences hypoxia signalling, protease secretion, tumour cell motility and adhesion, and thus can affect the propensity for invasion and metastasis. Therefore, the IGF1R is now an attractive anti-cancer treatment target.

  • Bhr C, et al. (2004) The insulin like growth factor-1 receptor (IGF-1R) as a drug target: novel approaches to cancer therapy. Growth Horm IGF Res. 14 (4): 287-95.
  • Riedemann J, et al. (2006) IGF1R signalling and its inhibition. Endocr Relat Cancer. 13 Suppl 1: 33-43.
  • Gualco E, et al. (2009) IGF-IR in neuroprotection and brain tumors. Front Biosci. 14: 352-75.
  • Annenkov A. (2009) The insulin-like growth factor (IGF) receptor type 1 (IGF1R) as an essential component of the signalling network regulating neurogenesis. Mol Neurobiol. 40 (3): 195-215.
  • Size / Price
    List Price: $445.00  (Save $0.00)
    Price:$445.00      [How to order]
    Availability5 business days
    • Human CD221 / IGF1R Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged
    Recently Viewed Items