Quick Order

Text Size:AAA

Human RPS6KA6 / RSK4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
RPS6KA6cDNA Clone Product Information
cDNA Size:2238
cDNA Description:ORF Clone of Homo sapiens ribosomal protein S6 kinase, 90kDa, polypeptide 6 (RPS6KA6) DNA.
Gene Synonym:RPS6KA6, RSK4
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human RPS6KA6 / RSK4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged on other vectors
Human RPS6KA6 / RSK4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10147-ACG$345
Human RPS6KA6 / RSK4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10147-ACR$345
Human RPS6KA6 / RSK4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10147-ANG$345
Human RPS6KA6 / RSK4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10147-ANR$345
Human RPS6KA6 / RSK4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10147-CF$315
Human RPS6KA6 / RSK4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10147-CH$315
Human RPS6KA6 / RSK4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10147-CM$315
Human RPS6KA6 / RSK4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10147-CY$315
Human RPS6KA6 / RSK4 Gene cDNA Clone (full-length ORF Clone)HG10147-M$115
Human RPS6KA6 / RSK4 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10147-M-F$345
Human RPS6KA6 / RSK4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10147-NF$315
Human RPS6KA6 / RSK4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10147-NH$315
Human RPS6KA6 / RSK4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10147-NM$315
Human RPS6KA6 / RSK4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10147-NY$315
Human RPS6KA6 / RSK4 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10147-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name

Ribosomal protein S6 kinase alpha-6, also known as Ribosomal S6 kinase 4, 90 kDa ribosomal protein S6 kinase 6,RSK-4, RSK4 and RPS6KA6, is a protein which belongs to the protein kinase superfamily, AGC Ser/Thr protein kinase family and S6 kinase subfamily. RPS6KA6 contains one AGC-kinase C-terminal domain and two protein kinase domains. RPS6KA6 forms a complex with either ERK1 or ERK2 in quiescent cells. RPS6KA6 shows a high level of homology to three isolated members of the human RSK family. RSK2 is involved in Coffin-Lowry syndrome and nonspecific MRX. The localization of RPS6KA6 in the interval that is commonly deleted in mentally retarded males together with the high degree of amino acid identity with RSK2 suggests that RPS6KA6 plays a role in normal neuronal development. Further mutation analyses in males with X-linked mental retardation must prove that the gene of RPS6KA6 is indeed a novel MRX gene. RPS6KA6 is a serine/threonine kinase that may play a role in mediating the growth-factor and stress induced activation of the transcription factor CREB. RPS6KA6 is activated by multiple phosphorylations on threonine and serine residues.