Quick Order

Human CDH8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CDH8cDNA Clone Product Information
cDNA Size:2400
cDNA Description:ORF Clone of Homo sapiens cadherin 8, type 2 (CDH8) DNA.
Gene Synonym:CDH8, Nbla04261
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

Cadherins are integral membrane proteins that mediate calcium-dependent cell-cell adhesion. Type I cadherin proteins are composed of a large N-terminal extracellular domain, a single membrane-spanning domain, and a small, highly conserved C-terminal cytoplasmic domain. The extracellular domain consists of five subdomains, each containing a cadherin motif, and appears to determine the specificity of the protein's homophilic cell adhesion activity. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I  cadherins. Cadherin 8, also known as CDH 8, is a type I I classical cadherin belonging to the cadherin superfamily. As mainly expressed in brain, CDH8 is found in certain nerve cell lines, such as retinoblasts, glioma cells and neuroblasts, and is putatively involved in synaptic adhesion, axon outgrowth and guidance. Human Cadherin 8 is a 799 amino acid single-pass type I  transmembrane protein with a putative 29 aa signal sequence, and a 32 aa propeptide, a 560 aa mature extracellular domain, a 21 aa transmembrane domain and a 157 aa cytoplasmic domain. The human, mouse and rat proteins share approximately 98% homology.

  • Tanihara, H. et al., 1994, Cell Adhes. Comm. 2:15-26.
  • Kido, M. et al., 1998, Genomics 48:186-194.
  • Yamagata, K. et al., 1999, J. Biol. Chem. 274:19473-19479.
  • Nollet, F. et al., 2000, J. Mol. Biol. 299:551-572.
  • Blaschke, S. et al., 2002, Int. J. Cancer. 101 (4): 327-334.
  • Strausberg,R.L. et al., 2003, Proc. Natl. Acad. Sci. U.S.A. 99 (26): 16899–16903.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks