Quick Order

Mouse ITGB3 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse ITGB3 cDNA Clone Product Information
Gene_bank_ref_id:NM_016780.2
RefSeq ORF Size:2364bp
cDNA Description:Full length Clone DNA of Mus musculus integrin beta 3.
Gene Synonym:CD61, GP3A, INGRB3, MGC159221, MGC159223, Itgb3
Species:Mouse
Vector:pCMV3-untagged
Plasmid:pCMV3-mITGB3
Restriction Site:KpnI(two restriction sites) + XbaI (6.11kb + 1.88kb + 0.48kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 858G/A, 2163C/A, 2235T/C, 2286C/T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Mouse ITGB3 Gene Plasmid Map
Mouse ITGB3 natural ORF mammalian expression plasmid
Product nameProduct name
Size / Price
Catalog: MG50080-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn StockShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"