Quick Order

Text Size:AAA

Mouse FRZB / FIZ natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Mouse FRZB cDNA Clone Product Information
NCBI RefSeq:NM_011356.4
RefSeq ORF Size:972bp
cDNA Description:Full length Clone DNA of Mus musculus frizzled-related protein.
Gene Synonym:Frp, Sfrp3, fritz, frzb-1, frezzled, Frzb
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

FRZB also known as sFRP-3, is a secreted protein containing a domain similar to the putative Wnt-binding region of the frizzled family of transmembrane receptors. FRZB is widely expressed in adult mammalian tissues. In the Xenopus gastrula, FRZB is regulated as a typical Spemann organizer component. FRZB also functions as a competitor for the cell-surface G-protein receptor Frizzled. It is espically important in embryonic development. Defects in FRZB gene can cause female-specific osteoarthritis (OA) susceptibility. FRZB may serve an important role in determining hip shape and may modify the relationship between hip shape and OA.

Size / Price
Catalog: MG50077-UT
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"