Quick Order

Mouse SCARB2 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse SCARB2 cDNA Clone Product Information
Gene_bank_ref_id:NM_007644.3
RefSeq ORF Size:1437bp
cDNA Description:Full length Clone DNA of Mus musculus scavenger receptor class B, member 2.
Gene Synonym:LGP85, Cd36l2, LIMP-2, MLGP85, 9330185J12Rik, Scarb2
Species:Mouse
Vector:pCMV3-untagged
Plasmid:pCMV3-mSCARB2
Restriction Site:KpnI + XbaI (6.1kb + 1.44kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Lysosomal Integral Membrane Protein II (LIMPII), also known as SCARB2, LPG85, and CD36L2, is a type I II multi-pass membrane glycoprotein that is located primarily in limiting membranes of lysosomes and endosomes on all tissues and cell types so far examined. This protein may participate in membrane transportation and the reorganization of endosomal/lysosomal compartment. LIMPII is identified as a receptor for EV71 (human enterovirus species A, Enterovirus 71) and CVA16 (coxsackievirus A16) which are most frequently associated with hand, foot and mouth disease (HFMD). Expression of human LIMPII enables normally unsusceptible cell lines to support the viruses’ propagation and develop cytopathic effects. In addition, LIMPII also has been shown to bind thrombospondin-1, may contribute to the pro-adhesive changes of activated platelets during coagulation, and inflammation. Deficiency of the protein in mice impairs cell membrane transport processes and causes pelvic junction obstruction, deafness, and peripheral neuropathy.

References
  • Crombie, R. et al., 1998, J. Biol. Chem. 273: 4855-4863.
  • Febbraio, M. et al., 2001, J. Clin. Invest. 108: 785-791.
  • Kuronita, T. et al., 2002, J. Cell Sci. 115: 4117-4131.
  • Gamp, A.C. et al., 2003, Human Molecular Genetics. 12: 631-646.
  • Eskelinen, E.L. et al., 2003, Trends in Cell Biology. 13: 137-145.
  • Mulcahy, J.V. et al.,2004, Biochem. J. 377 (Pt 3): 741–747.
  • Yamayoshi, S. et al., 2009, Nat Med. 15 (7): 798-801.
  • Size / Price
    Catalog: MG50052-UT
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"